ID: 1003400856

View in Genome Browser
Species Human (GRCh38)
Location 6:5789661-5789683
Sequence CAAACCTGACACTTTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003400856_1003400858 3 Left 1003400856 6:5789661-5789683 CCAGGATCAAAGTGTCAGGTTTG No data
Right 1003400858 6:5789687-5789709 TCTCCTGCAGCCTCTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003400856 Original CRISPR CAAACCTGACACTTTGATCC TGG (reversed) Intergenic
No off target data available for this crispr