ID: 1003402088

View in Genome Browser
Species Human (GRCh38)
Location 6:5799092-5799114
Sequence ACTTGGAAGCAGTGACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003402088_1003402093 6 Left 1003402088 6:5799092-5799114 CCATCCAGTCACTGCTTCCAAGT No data
Right 1003402093 6:5799121-5799143 CTTATTGCTGTATACTCCAGAGG No data
1003402088_1003402094 11 Left 1003402088 6:5799092-5799114 CCATCCAGTCACTGCTTCCAAGT No data
Right 1003402094 6:5799126-5799148 TGCTGTATACTCCAGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003402088 Original CRISPR ACTTGGAAGCAGTGACTGGA TGG (reversed) Intergenic
No off target data available for this crispr