ID: 1003403455

View in Genome Browser
Species Human (GRCh38)
Location 6:5809621-5809643
Sequence ACCTGCACCGATGGCTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003403455_1003403460 11 Left 1003403455 6:5809621-5809643 CCTCCCGAGCCATCGGTGCAGGT No data
Right 1003403460 6:5809655-5809677 GTGCTCTGTGAATGTGCTTGTGG No data
1003403455_1003403461 22 Left 1003403455 6:5809621-5809643 CCTCCCGAGCCATCGGTGCAGGT No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003403455 Original CRISPR ACCTGCACCGATGGCTCGGG AGG (reversed) Intergenic
No off target data available for this crispr