ID: 1003403458

View in Genome Browser
Species Human (GRCh38)
Location 6:5809630-5809652
Sequence CATGGAGCTACCTGCACCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003403458_1003403462 25 Left 1003403458 6:5809630-5809652 CCATCGGTGCAGGTAGCTCCATG No data
Right 1003403462 6:5809678-5809700 ATGTGTGCAGGTGCATGCGATGG No data
1003403458_1003403460 2 Left 1003403458 6:5809630-5809652 CCATCGGTGCAGGTAGCTCCATG No data
Right 1003403460 6:5809655-5809677 GTGCTCTGTGAATGTGCTTGTGG No data
1003403458_1003403461 13 Left 1003403458 6:5809630-5809652 CCATCGGTGCAGGTAGCTCCATG No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003403458 Original CRISPR CATGGAGCTACCTGCACCGA TGG (reversed) Intergenic
No off target data available for this crispr