ID: 1003403459

View in Genome Browser
Species Human (GRCh38)
Location 6:5809648-5809670
Sequence CACATTCACAGAGCACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003403459_1003403461 -5 Left 1003403459 6:5809648-5809670 CCATGCAGTGCTCTGTGAATGTG No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data
1003403459_1003403464 29 Left 1003403459 6:5809648-5809670 CCATGCAGTGCTCTGTGAATGTG No data
Right 1003403464 6:5809700-5809722 GAATCCATTCATGCTATGAAGGG No data
1003403459_1003403462 7 Left 1003403459 6:5809648-5809670 CCATGCAGTGCTCTGTGAATGTG No data
Right 1003403462 6:5809678-5809700 ATGTGTGCAGGTGCATGCGATGG No data
1003403459_1003403463 28 Left 1003403459 6:5809648-5809670 CCATGCAGTGCTCTGTGAATGTG No data
Right 1003403463 6:5809699-5809721 GGAATCCATTCATGCTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003403459 Original CRISPR CACATTCACAGAGCACTGCA TGG (reversed) Intergenic
No off target data available for this crispr