ID: 1003403461

View in Genome Browser
Species Human (GRCh38)
Location 6:5809666-5809688
Sequence ATGTGCTTGTGGATGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003403455_1003403461 22 Left 1003403455 6:5809621-5809643 CCTCCCGAGCCATCGGTGCAGGT No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data
1003403457_1003403461 18 Left 1003403457 6:5809625-5809647 CCGAGCCATCGGTGCAGGTAGCT No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data
1003403459_1003403461 -5 Left 1003403459 6:5809648-5809670 CCATGCAGTGCTCTGTGAATGTG No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data
1003403458_1003403461 13 Left 1003403458 6:5809630-5809652 CCATCGGTGCAGGTAGCTCCATG No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data
1003403456_1003403461 19 Left 1003403456 6:5809624-5809646 CCCGAGCCATCGGTGCAGGTAGC No data
Right 1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003403461 Original CRISPR ATGTGCTTGTGGATGTGTGC AGG Intergenic
No off target data available for this crispr