ID: 1003406193

View in Genome Browser
Species Human (GRCh38)
Location 6:5828977-5828999
Sequence ATGCCTGAAGGTCCGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003406193_1003406206 19 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406206 6:5829019-5829041 CTCTGGCATGGGTGGGAACCGGG No data
1003406193_1003406205 18 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406205 6:5829018-5829040 TCTCTGGCATGGGTGGGAACCGG No data
1003406193_1003406199 7 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406199 6:5829007-5829029 ACCTACTGACCTCTCTGGCATGG No data
1003406193_1003406197 2 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406197 6:5829002-5829024 AGGCCACCTACTGACCTCTCTGG No data
1003406193_1003406201 8 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406201 6:5829008-5829030 CCTACTGACCTCTCTGGCATGGG No data
1003406193_1003406207 29 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406207 6:5829029-5829051 GGTGGGAACCGGGAGCTCGTTGG No data
1003406193_1003406203 12 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406203 6:5829012-5829034 CTGACCTCTCTGGCATGGGTGGG No data
1003406193_1003406202 11 Left 1003406193 6:5828977-5828999 CCTTAGGACGGACCTTCAGGCAT No data
Right 1003406202 6:5829011-5829033 ACTGACCTCTCTGGCATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003406193 Original CRISPR ATGCCTGAAGGTCCGTCCTA AGG (reversed) Intergenic
No off target data available for this crispr