ID: 1003408204

View in Genome Browser
Species Human (GRCh38)
Location 6:5840378-5840400
Sequence CTGTGTAAGTAGAAGTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003408204_1003408208 14 Left 1003408204 6:5840378-5840400 CCTTCATACTTCTACTTACACAG No data
Right 1003408208 6:5840415-5840437 ATAAGTCACTTAACTTCTCTGGG No data
1003408204_1003408205 -9 Left 1003408204 6:5840378-5840400 CCTTCATACTTCTACTTACACAG No data
Right 1003408205 6:5840392-5840414 CTTACACAGCTGTGTGACCTTGG No data
1003408204_1003408207 13 Left 1003408204 6:5840378-5840400 CCTTCATACTTCTACTTACACAG No data
Right 1003408207 6:5840414-5840436 GATAAGTCACTTAACTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003408204 Original CRISPR CTGTGTAAGTAGAAGTATGA AGG (reversed) Intergenic
No off target data available for this crispr