ID: 1003408784

View in Genome Browser
Species Human (GRCh38)
Location 6:5845193-5845215
Sequence TCTATTAACAAGGAAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003408774_1003408784 27 Left 1003408774 6:5845143-5845165 CCTTCCCCAAAGGACTTGGTAAC No data
Right 1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG No data
1003408778_1003408784 21 Left 1003408778 6:5845149-5845171 CCAAAGGACTTGGTAACTTGGAA No data
Right 1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG No data
1003408775_1003408784 23 Left 1003408775 6:5845147-5845169 CCCCAAAGGACTTGGTAACTTGG No data
Right 1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG No data
1003408777_1003408784 22 Left 1003408777 6:5845148-5845170 CCCAAAGGACTTGGTAACTTGGA No data
Right 1003408784 6:5845193-5845215 TCTATTAACAAGGAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003408784 Original CRISPR TCTATTAACAAGGAAATGGA GGG Intergenic
No off target data available for this crispr