ID: 1003409577

View in Genome Browser
Species Human (GRCh38)
Location 6:5850832-5850854
Sequence AGCTGGTCAGGAATGCTCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409577_1003409591 8 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409591 6:5850863-5850885 TGGCGGGACGGGTCCTCCACAGG No data
1003409577_1003409585 -9 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409585 6:5850846-5850868 TGACCAGCTGGGGATCCTGGCGG No data
1003409577_1003409593 21 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
1003409577_1003409586 -8 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409586 6:5850847-5850869 GACCAGCTGGGGATCCTGGCGGG No data
1003409577_1003409589 -3 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409577_1003409594 22 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409577_1003409588 -4 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409588 6:5850851-5850873 AGCTGGGGATCCTGGCGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409577 Original CRISPR AGCTGGTCAGGAATGCTCCG GGG (reversed) Intergenic
No off target data available for this crispr