ID: 1003409578

View in Genome Browser
Species Human (GRCh38)
Location 6:5850833-5850855
Sequence CAGCTGGTCAGGAATGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409578_1003409591 7 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409591 6:5850863-5850885 TGGCGGGACGGGTCCTCCACAGG No data
1003409578_1003409594 21 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409578_1003409585 -10 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409585 6:5850846-5850868 TGACCAGCTGGGGATCCTGGCGG No data
1003409578_1003409593 20 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
1003409578_1003409588 -5 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409588 6:5850851-5850873 AGCTGGGGATCCTGGCGGGACGG No data
1003409578_1003409589 -4 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409578_1003409586 -9 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409586 6:5850847-5850869 GACCAGCTGGGGATCCTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409578 Original CRISPR CAGCTGGTCAGGAATGCTCC GGG (reversed) Intergenic