ID: 1003409579

View in Genome Browser
Species Human (GRCh38)
Location 6:5850834-5850856
Sequence CCAGCTGGTCAGGAATGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409579_1003409588 -6 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409588 6:5850851-5850873 AGCTGGGGATCCTGGCGGGACGG No data
1003409579_1003409589 -5 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409579_1003409594 20 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409579_1003409586 -10 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409586 6:5850847-5850869 GACCAGCTGGGGATCCTGGCGGG No data
1003409579_1003409591 6 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409591 6:5850863-5850885 TGGCGGGACGGGTCCTCCACAGG No data
1003409579_1003409593 19 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409579 Original CRISPR CCAGCTGGTCAGGAATGCTC CGG (reversed) Intergenic