ID: 1003409584

View in Genome Browser
Species Human (GRCh38)
Location 6:5850844-5850866
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409584_1003409597 30 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409584_1003409596 22 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG No data
1003409584_1003409591 -4 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409591 6:5850863-5850885 TGGCGGGACGGGTCCTCCACAGG No data
1003409584_1003409594 10 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409584_1003409593 9 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409584 Original CRISPR GCCAGGATCCCCAGCTGGTC AGG (reversed) Intergenic