ID: 1003409587

View in Genome Browser
Species Human (GRCh38)
Location 6:5850849-5850871
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409587_1003409596 17 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG 0: 1
1: 0
2: 4
3: 42
4: 330
1003409587_1003409593 4 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
1003409587_1003409597 25 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409587_1003409594 5 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409587_1003409591 -9 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409591 6:5850863-5850885 TGGCGGGACGGGTCCTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409587 Original CRISPR GTCCCGCCAGGATCCCCAGC TGG (reversed) Intergenic