ID: 1003409589

View in Genome Browser
Species Human (GRCh38)
Location 6:5850852-5850874
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409579_1003409589 -5 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409574_1003409589 12 Left 1003409574 6:5850817-5850839 CCCGAGCGAGGAGGCCCCCGGAG No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409578_1003409589 -4 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409577_1003409589 -3 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409575_1003409589 11 Left 1003409575 6:5850818-5850840 CCGAGCGAGGAGGCCCCCGGAGC No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data
1003409576_1003409589 -2 Left 1003409576 6:5850831-5850853 CCCCCGGAGCATTCCTGACCAGC No data
Right 1003409589 6:5850852-5850874 GCTGGGGATCCTGGCGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409589 Original CRISPR GCTGGGGATCCTGGCGGGAC GGG Intergenic
No off target data available for this crispr