ID: 1003409590

View in Genome Browser
Species Human (GRCh38)
Location 6:5850861-5850883
Sequence TGTGGAGGACCCGTCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409590_1003409596 5 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG No data
1003409590_1003409597 13 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409590_1003409593 -8 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409593 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
1003409590_1003409594 -7 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409590 Original CRISPR TGTGGAGGACCCGTCCCGCC AGG (reversed) Intergenic