ID: 1003409594

View in Genome Browser
Species Human (GRCh38)
Location 6:5850877-5850899
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409587_1003409594 5 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409576_1003409594 23 Left 1003409576 6:5850831-5850853 CCCCCGGAGCATTCCTGACCAGC No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409579_1003409594 20 Left 1003409579 6:5850834-5850856 CCGGAGCATTCCTGACCAGCTGG No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409577_1003409594 22 Left 1003409577 6:5850832-5850854 CCCCGGAGCATTCCTGACCAGCT No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409584_1003409594 10 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409578_1003409594 21 Left 1003409578 6:5850833-5850855 CCCGGAGCATTCCTGACCAGCTG No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data
1003409590_1003409594 -7 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409594 6:5850877-5850899 CTCCACAGGAGCATTTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409594 Original CRISPR CTCCACAGGAGCATTTTCTA GGG Intergenic