ID: 1003409596

View in Genome Browser
Species Human (GRCh38)
Location 6:5850889-5850911
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409592_1003409596 -10 Left 1003409592 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG 0: 1
1: 0
2: 4
3: 42
4: 330
1003409584_1003409596 22 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG 0: 1
1: 0
2: 4
3: 42
4: 330
1003409590_1003409596 5 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG 0: 1
1: 0
2: 4
3: 42
4: 330
1003409587_1003409596 17 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409596 6:5850889-5850911 ATTTTCTAGGGTGTGTTCTGTGG 0: 1
1: 0
2: 4
3: 42
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409596 Original CRISPR ATTTTCTAGGGTGTGTTCTG TGG Intergenic