ID: 1003409597

View in Genome Browser
Species Human (GRCh38)
Location 6:5850897-5850919
Sequence GGGTGTGTTCTGTGGAACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003409592_1003409597 -2 Left 1003409592 6:5850876-5850898 CCTCCACAGGAGCATTTTCTAGG No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409584_1003409597 30 Left 1003409584 6:5850844-5850866 CCTGACCAGCTGGGGATCCTGGC No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409595_1003409597 -5 Left 1003409595 6:5850879-5850901 CCACAGGAGCATTTTCTAGGGTG No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409587_1003409597 25 Left 1003409587 6:5850849-5850871 CCAGCTGGGGATCCTGGCGGGAC No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data
1003409590_1003409597 13 Left 1003409590 6:5850861-5850883 CCTGGCGGGACGGGTCCTCCACA No data
Right 1003409597 6:5850897-5850919 GGGTGTGTTCTGTGGAACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003409597 Original CRISPR GGGTGTGTTCTGTGGAACGC TGG Intergenic