ID: 1003411005

View in Genome Browser
Species Human (GRCh38)
Location 6:5863000-5863022
Sequence GCTTAGAGAGGCAGCCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003411005_1003411010 -2 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411010 6:5863021-5863043 GCCTGGGGTCTGTCTCTGTGAGG No data
1003411005_1003411016 17 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411016 6:5863040-5863062 GAGGAGCAGAGGGCAGGCCTGGG No data
1003411005_1003411012 6 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411012 6:5863029-5863051 TCTGTCTCTGTGAGGAGCAGAGG No data
1003411005_1003411017 18 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411017 6:5863041-5863063 AGGAGCAGAGGGCAGGCCTGGGG No data
1003411005_1003411013 7 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411013 6:5863030-5863052 CTGTCTCTGTGAGGAGCAGAGGG No data
1003411005_1003411014 11 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411014 6:5863034-5863056 CTCTGTGAGGAGCAGAGGGCAGG No data
1003411005_1003411015 16 Left 1003411005 6:5863000-5863022 CCTGGTTGGCTGCCTCTCTAAGC No data
Right 1003411015 6:5863039-5863061 TGAGGAGCAGAGGGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003411005 Original CRISPR GCTTAGAGAGGCAGCCAACC AGG (reversed) Intergenic
No off target data available for this crispr