ID: 1003411470

View in Genome Browser
Species Human (GRCh38)
Location 6:5866757-5866779
Sequence GTCGGACAAGTCTGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003411467_1003411470 -4 Left 1003411467 6:5866738-5866760 CCAAATCATTTATCAAAATGTCG No data
Right 1003411470 6:5866757-5866779 GTCGGACAAGTCTGCAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003411470 Original CRISPR GTCGGACAAGTCTGCAGTGA GGG Intergenic
No off target data available for this crispr