ID: 1003414612

View in Genome Browser
Species Human (GRCh38)
Location 6:5896801-5896823
Sequence GTCCCTTCCTCTAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003414605_1003414612 5 Left 1003414605 6:5896773-5896795 CCAGGGTCGGGAGGAAGAGGCTG No data
Right 1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003414612 Original CRISPR GTCCCTTCCTCTAGGGTGGG AGG Intergenic
No off target data available for this crispr