ID: 1003416127

View in Genome Browser
Species Human (GRCh38)
Location 6:5909934-5909956
Sequence CACCGTATGCGCTCCCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003416127_1003416136 28 Left 1003416127 6:5909934-5909956 CCTTATTGGGAGCGCATACGGTG No data
Right 1003416136 6:5909985-5910007 TCCCAGGAGCAGATGGCGTGTGG No data
1003416127_1003416132 -5 Left 1003416127 6:5909934-5909956 CCTTATTGGGAGCGCATACGGTG No data
Right 1003416132 6:5909952-5909974 CGGTGGAATGCCTGGGGATGAGG No data
1003416127_1003416135 21 Left 1003416127 6:5909934-5909956 CCTTATTGGGAGCGCATACGGTG No data
Right 1003416135 6:5909978-5910000 GAGAGAATCCCAGGAGCAGATGG No data
1003416127_1003416134 12 Left 1003416127 6:5909934-5909956 CCTTATTGGGAGCGCATACGGTG No data
Right 1003416134 6:5909969-5909991 ATGAGGTCAGAGAGAATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003416127 Original CRISPR CACCGTATGCGCTCCCAATA AGG (reversed) Intergenic