ID: 1003418914

View in Genome Browser
Species Human (GRCh38)
Location 6:5938438-5938460
Sequence GGGCTCCTCCGCTGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003418914_1003418921 2 Left 1003418914 6:5938438-5938460 CCCAGGCTTCAGCGGAGGAGCCC No data
Right 1003418921 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data
1003418914_1003418923 28 Left 1003418914 6:5938438-5938460 CCCAGGCTTCAGCGGAGGAGCCC No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418914_1003418924 29 Left 1003418914 6:5938438-5938460 CCCAGGCTTCAGCGGAGGAGCCC No data
Right 1003418924 6:5938490-5938512 AATCCCACACCACCTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003418914 Original CRISPR GGGCTCCTCCGCTGAAGCCT GGG (reversed) Intergenic