ID: 1003418921

View in Genome Browser
Species Human (GRCh38)
Location 6:5938463-5938485
Sequence CCGTGGATATTCAAATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003418909_1003418921 23 Left 1003418909 6:5938417-5938439 CCATGTGCTCACCAGAGACATCC No data
Right 1003418921 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data
1003418911_1003418921 12 Left 1003418911 6:5938428-5938450 CCAGAGACATCCCAGGCTTCAGC No data
Right 1003418921 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data
1003418914_1003418921 2 Left 1003418914 6:5938438-5938460 CCCAGGCTTCAGCGGAGGAGCCC No data
Right 1003418921 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data
1003418915_1003418921 1 Left 1003418915 6:5938439-5938461 CCAGGCTTCAGCGGAGGAGCCCC No data
Right 1003418921 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003418921 Original CRISPR CCGTGGATATTCAAATGAAC AGG Intergenic
No off target data available for this crispr