ID: 1003418923

View in Genome Browser
Species Human (GRCh38)
Location 6:5938489-5938511
Sequence CAATCCCACACCACCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003418917_1003418923 8 Left 1003418917 6:5938458-5938480 CCCCTCCGTGGATATTCAAATGA No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418915_1003418923 27 Left 1003418915 6:5938439-5938461 CCAGGCTTCAGCGGAGGAGCCCC No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418914_1003418923 28 Left 1003418914 6:5938438-5938460 CCCAGGCTTCAGCGGAGGAGCCC No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418918_1003418923 7 Left 1003418918 6:5938459-5938481 CCCTCCGTGGATATTCAAATGAA No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418920_1003418923 3 Left 1003418920 6:5938463-5938485 CCGTGGATATTCAAATGAACAGG No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data
1003418919_1003418923 6 Left 1003418919 6:5938460-5938482 CCTCCGTGGATATTCAAATGAAC No data
Right 1003418923 6:5938489-5938511 CAATCCCACACCACCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003418923 Original CRISPR CAATCCCACACCACCTGCAG AGG Intergenic
No off target data available for this crispr