ID: 1003421602

View in Genome Browser
Species Human (GRCh38)
Location 6:5963409-5963431
Sequence CTGCAAGGATTGGGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003421602_1003421607 -8 Left 1003421602 6:5963409-5963431 CCATGTTGCCCCAATCCTTGCAG No data
Right 1003421607 6:5963424-5963446 CCTTGCAGACAACCCAAACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003421602 Original CRISPR CTGCAAGGATTGGGGCAACA TGG (reversed) Intergenic
No off target data available for this crispr