ID: 1003422197

View in Genome Browser
Species Human (GRCh38)
Location 6:5968632-5968654
Sequence GGGTGTGGCCTGGGCATTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003422197_1003422209 8 Left 1003422197 6:5968632-5968654 CCCCCAATGCCCAGGCCACACCC No data
Right 1003422209 6:5968663-5968685 TTATGTCAGAGCCTCTGGAGTGG No data
1003422197_1003422210 9 Left 1003422197 6:5968632-5968654 CCCCCAATGCCCAGGCCACACCC No data
Right 1003422210 6:5968664-5968686 TATGTCAGAGCCTCTGGAGTGGG No data
1003422197_1003422207 3 Left 1003422197 6:5968632-5968654 CCCCCAATGCCCAGGCCACACCC No data
Right 1003422207 6:5968658-5968680 ACCAATTATGTCAGAGCCTCTGG No data
1003422197_1003422211 16 Left 1003422197 6:5968632-5968654 CCCCCAATGCCCAGGCCACACCC No data
Right 1003422211 6:5968671-5968693 GAGCCTCTGGAGTGGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003422197 Original CRISPR GGGTGTGGCCTGGGCATTGG GGG (reversed) Intergenic
No off target data available for this crispr