ID: 1003425438

View in Genome Browser
Species Human (GRCh38)
Location 6:5995530-5995552
Sequence CAGAGCCCTGCCTGGGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003425438_1003425443 5 Left 1003425438 6:5995530-5995552 CCTCGGGCCCAGGCAGGGCTCTG No data
Right 1003425443 6:5995558-5995580 GGCCTGACATGTTCATAATAAGG No data
1003425438_1003425445 19 Left 1003425438 6:5995530-5995552 CCTCGGGCCCAGGCAGGGCTCTG No data
Right 1003425445 6:5995572-5995594 ATAATAAGGATTGTCAGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003425438 Original CRISPR CAGAGCCCTGCCTGGGCCCG AGG (reversed) Intergenic
No off target data available for this crispr