ID: 1003426004

View in Genome Browser
Species Human (GRCh38)
Location 6:5998939-5998961
Sequence AGTGTGGGTGGGCGCGCGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 598}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003425995_1003426004 -7 Left 1003425995 6:5998923-5998945 CCGGGAGCATGGAGTGAGTGTGG 0: 1
1: 0
2: 4
3: 22
4: 257
Right 1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG 0: 1
1: 0
2: 0
3: 41
4: 598
1003425989_1003426004 25 Left 1003425989 6:5998891-5998913 CCCAAAGAACTAATGGATCTTCC 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG 0: 1
1: 0
2: 0
3: 41
4: 598
1003425990_1003426004 24 Left 1003425990 6:5998892-5998914 CCAAAGAACTAATGGATCTTCCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG 0: 1
1: 0
2: 0
3: 41
4: 598
1003425993_1003426004 4 Left 1003425993 6:5998912-5998934 CCTCTCGATTTCCGGGAGCATGG 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG 0: 1
1: 0
2: 0
3: 41
4: 598
1003425988_1003426004 26 Left 1003425988 6:5998890-5998912 CCCCAAAGAACTAATGGATCTTC 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1003426004 6:5998939-5998961 AGTGTGGGTGGGCGCGCGGGGGG 0: 1
1: 0
2: 0
3: 41
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003426004 Original CRISPR AGTGTGGGTGGGCGCGCGGG GGG Exonic