ID: 1003426115

View in Genome Browser
Species Human (GRCh38)
Location 6:5999404-5999426
Sequence CTGTCTAAAGCGGGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003426101_1003426115 -1 Left 1003426101 6:5999382-5999404 CCTCCGCCTACCCCAGAAGCGGC 0: 1
1: 0
2: 1
3: 12
4: 360
Right 1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176
1003426102_1003426115 -4 Left 1003426102 6:5999385-5999407 CCGCCTACCCCAGAAGCGGCTGT 0: 1
1: 0
2: 2
3: 15
4: 175
Right 1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176
1003426103_1003426115 -7 Left 1003426103 6:5999388-5999410 CCTACCCCAGAAGCGGCTGTCTA 0: 1
1: 0
2: 0
3: 1
4: 110
Right 1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176
1003426096_1003426115 30 Left 1003426096 6:5999351-5999373 CCTGGCCTGCGCGAGGTCGGGAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176
1003426097_1003426115 25 Left 1003426097 6:5999356-5999378 CCTGCGCGAGGTCGGGACTCGCG 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003426115 Original CRISPR CTGTCTAAAGCGGGGGTGGG GGG Intronic
904457753 1:30657639-30657661 CTGCCTTCAGAGGGGGTGGGAGG - Intergenic
905468197 1:38171812-38171834 CTGTATGGAGTGGGGGTGGGAGG - Intergenic
907270370 1:53287710-53287732 CTGTGAAAAGCGGGCCTGGGAGG + Intronic
908131768 1:61082056-61082078 AGGTCTGCAGCGGGGGTGGGGGG + Intronic
908227215 1:62068036-62068058 CTGTGTAAGGCCGAGGTGGGTGG - Intronic
909565692 1:77051098-77051120 ATGGCAAAAGCTGGGGTGGGGGG + Intronic
910610992 1:89141895-89141917 TTGTCTGCACCGGGGGTGGGTGG - Intronic
910614974 1:89187363-89187385 TTGTCTGCACCGGGGGTGGGTGG - Intronic
914220832 1:145680653-145680675 CTCTCTGGGGCGGGGGTGGGGGG - Intronic
915173069 1:153991864-153991886 CTGTCTAAAGCGGGGATAAATGG + Intronic
915253440 1:154607515-154607537 GGGGCTAAAGCGGGGGTAGGGGG + Intronic
915437681 1:155921130-155921152 CTGTTTAAAGTGGGGATGGTGGG - Intronic
916159734 1:161897328-161897350 CAGGCTGAGGCGGGGGTGGGTGG + Intronic
916383588 1:164241663-164241685 ATTTTTAAAGTGGGGGTGGGAGG + Intergenic
916656839 1:166884248-166884270 CTGCAGAAAGCGGGTGTGGGAGG + Intergenic
918679896 1:187340844-187340866 CTTTCAAAAGCTGGGATGGGAGG + Intergenic
919728151 1:200897005-200897027 CTGGCTGCAGCAGGGGTGGGAGG - Intronic
920374322 1:205499247-205499269 CTGTCTGAAGGAGGGGTGTGGGG + Intergenic
920931418 1:210392677-210392699 CTTTGTAAAGCAGAGGTGGGAGG - Intronic
923485793 1:234429753-234429775 CTTTCTAAAGGTGGGGGGGGGGG + Intronic
1063602410 10:7494185-7494207 CTCTCCAAAGCAGTGGTGGGAGG - Intergenic
1069749526 10:70736404-70736426 CTCTGTAAAGCGGGGGAGGGAGG + Intronic
1071444701 10:85735189-85735211 CTGTCAAAAGTGGGTGTGTGCGG - Intronic
1075587886 10:123670630-123670652 CTGGTTAGAGCTGGGGTGGGAGG - Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1078865731 11:15295681-15295703 CTGTCTAAGGCTGGGCTGGCTGG - Intergenic
1083332862 11:61907088-61907110 CTTTGTAAAGTGGGGCTGGGAGG + Intronic
1083659447 11:64245462-64245484 CTGCCCAAAGCGGGGTGGGGGGG + Intronic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084835936 11:71801930-71801952 CTGGCTTGAGCGTGGGTGGGTGG - Intergenic
1084871421 11:72101046-72101068 CTGTCTGAAGTGGAGCTGGGAGG - Intronic
1084995736 11:72976521-72976543 CTTTGGAAGGCGGGGGTGGGAGG - Intronic
1086235583 11:84626342-84626364 CTCTTGAAAGCTGGGGTGGGAGG + Intronic
1088247969 11:107837901-107837923 GTGTATAAGGTGGGGGTGGGTGG - Intronic
1092345541 12:7711682-7711704 CTGACTATAGGGGGGTTGGGAGG + Intronic
1093508012 12:19891959-19891981 CTGTCTCGAGGAGGGGTGGGGGG + Intergenic
1095646773 12:44557163-44557185 CTTTCCAAAGCAGAGGTGGGGGG - Intronic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1099681602 12:85836614-85836636 GTGTGGAAAGCGGGGGAGGGGGG - Intergenic
1101259061 12:103010698-103010720 CTGTCTAAAGCCAGTGTGTGAGG - Intergenic
1106576010 13:30976397-30976419 CTGTCTAAAGCAGGGATGGTTGG - Intergenic
1108662494 13:52599878-52599900 CTGGCTAAAGCTGGGGCGGTAGG + Intergenic
1113468933 13:110530787-110530809 CTGTGTAGAGGTGGGGTGGGTGG - Intronic
1116799715 14:49429844-49429866 CTGTGAGAAGCAGGGGTGGGTGG - Intergenic
1117052698 14:51877509-51877531 GTTTCTGAAACGGGGGTGGGTGG - Intronic
1118474045 14:66100848-66100870 CTGCCTAAGGTGGGAGTGGGGGG - Intergenic
1120368272 14:83598666-83598688 CTGTGTATAGTGGGGTTGGGAGG - Intergenic
1120751810 14:88204588-88204610 CTGCCTGCAGCGGGGGTAGGGGG - Intronic
1120813150 14:88825271-88825293 CAGTCTAAAGATGAGGTGGGAGG - Intronic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1122221569 14:100241968-100241990 CTGTCTCAAAAGGGGGGGGGGGG + Intronic
1122574273 14:102731927-102731949 CTGTCTGAAGCCGGGGTTGTGGG - Intergenic
1122584610 14:102796520-102796542 GTGTCTGAAGTGGGGATGGGGGG + Intronic
1202871028 14_GL000225v1_random:164091-164113 TTGACTAAATCTGGGGTGGGGGG + Intergenic
1127670112 15:61187102-61187124 CTTTCAAAAGCGGCGGTGGCAGG + Intronic
1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG + Intronic
1128976016 15:72154092-72154114 CTGTCATAACCAGGGGTGGGGGG + Intergenic
1131406505 15:92169370-92169392 GTGTCTAAAGGTGGGGAGGGAGG - Intronic
1132879653 16:2156405-2156427 CTGTCTAGATGGGGGATGGGGGG - Intronic
1134270843 16:12731674-12731696 CTGACAAATGCGGGGGAGGGAGG - Intronic
1136072050 16:27793249-27793271 GTGTCCATAGCTGGGGTGGGGGG + Intronic
1136383082 16:29905974-29905996 CTCTCTACTGCGGGGGTGGGCGG + Exonic
1137056661 16:35749357-35749379 CTGGCTGAAGCTTGGGTGGGGGG + Intergenic
1137693115 16:50442836-50442858 CTGTATTAAGCGGGGGGGGGGGG + Intergenic
1139460270 16:67116604-67116626 CTTTAGAAAGCGGAGGTGGGAGG + Intronic
1140063661 16:71592035-71592057 CTGTCTCTAGCGGGGGGGGGGGG - Intergenic
1142270358 16:89085789-89085811 GTGCCTAAAGGTGGGGTGGGAGG - Intergenic
1142375134 16:89702573-89702595 CTGCCCAAAGCGGGGGTGTGGGG - Intergenic
1142567567 17:850578-850600 CTGTCTCCAGTGGGGCTGGGGGG + Intronic
1145084535 17:19925697-19925719 CTCTCTATAGCAGGGGTGGGAGG + Intronic
1145369126 17:22294248-22294270 CTGGCTACAGGGTGGGTGGGAGG - Intergenic
1149444840 17:56705468-56705490 CTGTCTCCTGCGGGGGGGGGCGG - Intergenic
1149772014 17:59330200-59330222 GAGTCTAAAACGGGGGGGGGGGG - Intergenic
1150715908 17:67572458-67572480 CTGGGTAAAGCGGGGGGGGGGGG + Intronic
1152049070 17:77958671-77958693 CTGGCTGAAGCGGGGGGAGGGGG + Intergenic
1152971090 18:161567-161589 CAGCCTAATGGGGGGGTGGGAGG - Intronic
1153284781 18:3448059-3448081 CTGGCTAAAGCGGGCGGGGGGGG + Intronic
1157260106 18:46170008-46170030 CTGGCTATGGTGGGGGTGGGTGG + Intergenic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1158455611 18:57604644-57604666 CTTTGGAAAGCTGGGGTGGGAGG + Intronic
1160841170 19:1147615-1147637 CTGTGTCCAGTGGGGGTGGGAGG - Intronic
1160917766 19:1505859-1505881 GTGTCTTAAGCGTGTGTGGGAGG + Exonic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161615950 19:5270291-5270313 GTCTCTAAAAGGGGGGTGGGGGG - Intronic
1161927609 19:7312907-7312929 GTGTCTCAGGCAGGGGTGGGAGG - Intergenic
1164533780 19:29068795-29068817 CTTTGTCAAGTGGGGGTGGGGGG - Intergenic
1164734781 19:30532732-30532754 CTGTCTAAAGCTAGGGTATGTGG + Intronic
1167209523 19:48124769-48124791 CTTTGGAAAGCGGAGGTGGGTGG + Intronic
1167898626 19:52601679-52601701 CCGTCGAAGGCGAGGGTGGGAGG - Intronic
925195435 2:1920239-1920261 CTGTATAAATGGGGGTTGGGTGG - Intronic
928118827 2:28566986-28567008 CTGTCGGAAGCGGAGCTGGGCGG - Intronic
931727078 2:65121775-65121797 CCCTCTAAAGCGGGGGCCGGGGG + Intronic
932322394 2:70831752-70831774 CTGACTAAAGCAGGGATGGAAGG - Exonic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
932832928 2:75008220-75008242 CTGTCTAAGGCCAGAGTGGGTGG + Intergenic
933040752 2:77462899-77462921 GTGTGTGTAGCGGGGGTGGGGGG + Intronic
933711239 2:85327588-85327610 TTGGCTCAAGCTGGGGTGGGTGG + Exonic
934612946 2:95754217-95754239 CTGTCTCTAGCGGGGCTGGTGGG + Intergenic
939538179 2:143459324-143459346 CTGGTTAAATGGGGGGTGGGGGG + Intronic
939596881 2:144136319-144136341 CTGTCAAAAGAGGGGAGGGGAGG + Intronic
941867953 2:170354316-170354338 CTGTCTAGAGCAGAGATGGGTGG + Intronic
944898867 2:204194439-204194461 ATTTCTAAAGCAGGGATGGGAGG - Intergenic
947666235 2:231907519-231907541 CTGTTTGAAGCAGGTGTGGGAGG - Intergenic
947839192 2:233196845-233196867 CTGTGTACAGCGGGGGTGGCTGG - Intronic
947865984 2:233398083-233398105 ATGCCAAAATCGGGGGTGGGGGG - Intronic
1168981235 20:2005746-2005768 ATGTCTACAATGGGGGTGGGTGG - Intergenic
1174347425 20:49940763-49940785 CTGTCTCAAGGGGGGGGTGGAGG - Intronic
1178270607 21:31186211-31186233 CTCTCTAAAGAAGGGGAGGGAGG + Intronic
1178919094 21:36726851-36726873 CTGTCTACATCTGGGCTGGGAGG + Intronic
1179557991 21:42192958-42192980 CTGTCTAATGGGGGGTGGGGTGG - Intergenic
1180197771 21:46207840-46207862 CTGTTTACAATGGGGGTGGGGGG - Intronic
1182101391 22:27659959-27659981 CTGTCCACACCTGGGGTGGGAGG - Intergenic
1183403470 22:37618372-37618394 CTGTCCAAGGCGTGGGAGGGAGG + Intronic
1184676998 22:46048948-46048970 CTGTGGAAAGCTGAGGTGGGTGG - Intergenic
1185017150 22:48351507-48351529 CTGTCCACAGTGGGGGTGTGGGG + Intergenic
950191037 3:10976336-10976358 GTGTCTGACCCGGGGGTGGGAGG - Intergenic
951490109 3:23260785-23260807 CTGTCTCAGGTGGGGGTTGGAGG + Intronic
953612177 3:44456170-44456192 CTTTGGAAAGCGGAGGTGGGAGG + Intronic
953632286 3:44629273-44629295 TTGTCTAAAGTGTAGGTGGGAGG - Exonic
954173353 3:48823303-48823325 GTGTCTAAAGGGGGTGTCGGGGG + Intronic
954406421 3:50347795-50347817 CTGTATAAAGCCGGGCAGGGTGG + Exonic
958464662 3:94442991-94443013 CTGTGGAGAGCGGGAGTGGGGGG - Intergenic
959725215 3:109534431-109534453 CTATCTAAAGCGGGGCACGGTGG - Intergenic
960180147 3:114566378-114566400 CTGGCTAAAGAAGAGGTGGGTGG + Intronic
967954480 3:194867870-194867892 ATGTCTCTGGCGGGGGTGGGGGG - Intergenic
968682227 4:1929102-1929124 TTGTCTAGAGAGGTGGTGGGTGG + Intronic
969232787 4:5843222-5843244 CTGTCTAACCAGGGGGTTGGAGG - Intronic
969489626 4:7491736-7491758 CTGCCTTAACGGGGGGTGGGTGG - Intronic
969617601 4:8262655-8262677 GTGGTGAAAGCGGGGGTGGGTGG - Intergenic
970771212 4:19614955-19614977 CTGCTTAGAGCGTGGGTGGGGGG - Intergenic
971643296 4:29163016-29163038 CTGTGGAAAGTGGGGGGGGGGGG + Intergenic
980166950 4:129240761-129240783 ATGTATGAGGCGGGGGTGGGAGG - Intergenic
981723733 4:147826498-147826520 CTGTCCAAAGCTGGGGTGGGTGG + Intronic
982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG + Intergenic
982457684 4:155629535-155629557 CACTCTAGAGCGGGAGTGGGTGG + Intergenic
989267181 5:39489463-39489485 CTGTCTCAAGCTGAGGTAGGGGG - Intergenic
991590318 5:68244524-68244546 CTCTCTGAAGCGGCGGCGGGGGG - Intronic
998463456 5:142325518-142325540 CAGTCAAAAGGGGGGGCGGGAGG + Intronic
1000618906 5:163460567-163460589 TTGGCTAACGCCGGGGTGGGTGG + Exonic
1001588368 5:172848915-172848937 CTGCCTGAAGGAGGGGTGGGTGG + Intronic
1001793565 5:174482931-174482953 CTCTGTAGAACGGGGGTGGGAGG - Intergenic
1002159777 5:177308169-177308191 CTGCCTAGATTGGGGGTGGGGGG + Intronic
1002274823 5:178097271-178097293 CTCTCTAAAATGGGGGTGGTAGG - Intergenic
1002663673 5:180807615-180807637 CTGATTAAAGAGGGGGTGGAAGG - Intronic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1005236434 6:23766859-23766881 CTGTCTGAGGCTGAGGTGGGAGG - Intergenic
1006337116 6:33426614-33426636 ATGACTAAAGAGGGGGTTGGGGG - Intronic
1010944688 6:81960060-81960082 CTGTCTAAAGAAGAGTTGGGGGG - Intergenic
1012896048 6:104950734-104950756 CTGCTAAAAGTGGGGGTGGGGGG - Intergenic
1017503637 6:155047629-155047651 CCTTCTAAGGCAGGGGTGGGGGG + Intronic
1018968291 6:168506204-168506226 CTGTCTCTATCAGGGGTGGGAGG - Intronic
1020892530 7:13897135-13897157 CTCTCAAAACCCGGGGTGGGGGG + Intronic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1026735406 7:72945742-72945764 CTGTCTGAGGAGGGGTTGGGCGG + Intronic
1026901556 7:74040193-74040215 CTGTCCACAGAGGGGCTGGGAGG - Intronic
1029725710 7:102402762-102402784 ATGTCTCAAGCAGGGGTGAGTGG - Intronic
1029783683 7:102763567-102763589 TTGTCTCAAGCTGGGGTGAGAGG + Intronic
1033988041 7:147250536-147250558 CTGTCAGATGGGGGGGTGGGGGG - Intronic
1034540496 7:151755087-151755109 CTGTCCTGAGCGGGGGTCGGGGG + Intronic
1035714869 8:1746293-1746315 CAGTCACAAGCTGGGGTGGGTGG - Intergenic
1035876929 8:3200633-3200655 CTGTGTCAAGCAGTGGTGGGAGG + Intronic
1036679718 8:10862908-10862930 CTGGGTAATGCAGGGGTGGGGGG + Intergenic
1039284129 8:36021962-36021984 TTATCTGAAGCGTGGGTGGGAGG + Intergenic
1041197243 8:55412273-55412295 CTCTCTAAAGCTGCAGTGGGAGG + Intronic
1046871488 8:119209058-119209080 CTGTGGAAAGTGGGGGCGGGAGG + Intronic
1047971994 8:130092381-130092403 CTGTAGAAAGCTGAGGTGGGAGG + Intronic
1048423842 8:134304282-134304304 CTGGCAGAAGTGGGGGTGGGGGG + Intergenic
1050433110 9:5582057-5582079 CTGTCAGAAGCGGGGGTAGGAGG + Intergenic
1052220331 9:26014134-26014156 TTGTCTAAAGGGGGAGTGGGTGG + Intergenic
1053003499 9:34590403-34590425 CTGCCCAAAGTGGGGGTTGGGGG - Intergenic
1055047848 9:71948814-71948836 CTATTTAAAGGGGGGGGGGGGGG - Intronic
1055314949 9:75025072-75025094 CTGTCTGAAATGGGGTTGGGGGG + Intronic
1055540807 9:77303304-77303326 CAGTCTAATGCAGGGGTTGGTGG + Intronic
1056809063 9:89750254-89750276 CTGTGTCAAGCGAGGGGGGGGGG + Intergenic
1057142398 9:92735349-92735371 CTATCAAAAGTGGGGATGGGCGG + Intronic
1061024796 9:128041513-128041535 GTGTCTGAAGTGGGGGTGGTGGG + Intergenic
1203733424 Un_GL000216v2:112494-112516 GTGACTAAATCTGGGGTGGGGGG - Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186881909 X:13874941-13874963 GAGTTTGAAGCGGGGGTGGGGGG - Intronic
1189813770 X:44804438-44804460 CTGTCACAAGCTGGGGTGGAGGG + Intergenic
1190291822 X:48998177-48998199 GTGCCTAAAGTGGGGGTGGGTGG + Exonic
1190711106 X:53071216-53071238 CTTTCAGAAGCGGAGGTGGGCGG - Intronic
1192008905 X:67247262-67247284 CTGGCAAAATCTGGGGTGGGGGG + Intergenic
1192550926 X:72052832-72052854 ATGTCTACAGAGGGGCTGGGGGG - Intergenic
1195693981 X:107653192-107653214 CAGACTAAAGCAGGGGTAGGAGG + Intergenic
1196892983 X:120308615-120308637 CTGTCTAAAGTGGGGAGGGATGG - Intronic
1196990121 X:121319702-121319724 CTTTTTAAGGCGGGGGCGGGGGG - Intergenic
1198210357 X:134510505-134510527 TTTTCTAATCCGGGGGTGGGCGG + Intronic
1198730265 X:139720766-139720788 TTTTTTAAAGCGGGGGGGGGGGG - Intergenic
1199991243 X:152988784-152988806 CTGTGTGAAACTGGGGTGGGAGG - Intergenic
1200149990 X:153946678-153946700 CTGTGTCATGTGGGGGTGGGGGG - Intergenic
1200226436 X:154420242-154420264 CTGTCCAAAGCGGGGGAAGTAGG - Exonic
1202627583 Y:56875922-56875944 GTGACTAAATCTGGGGTGGGGGG + Intergenic