ID: 1003429510

View in Genome Browser
Species Human (GRCh38)
Location 6:6026058-6026080
Sequence GCTGCTCACCTCCAGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003429510_1003429515 22 Left 1003429510 6:6026058-6026080 CCAGTGAGCTGGAGGTGAGCAGC No data
Right 1003429515 6:6026103-6026125 GCTCTCCAGTACCTCACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003429510 Original CRISPR GCTGCTCACCTCCAGCTCAC TGG (reversed) Intergenic
No off target data available for this crispr