ID: 1003439717

View in Genome Browser
Species Human (GRCh38)
Location 6:6128304-6128326
Sequence TAGACTATACACAGGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003439717_1003439722 9 Left 1003439717 6:6128304-6128326 CCAAAATGCCTGTGTATAGTCTA No data
Right 1003439722 6:6128336-6128358 AATACAAAGAGAAGTAGGCTGGG No data
1003439717_1003439721 8 Left 1003439717 6:6128304-6128326 CCAAAATGCCTGTGTATAGTCTA No data
Right 1003439721 6:6128335-6128357 TAATACAAAGAGAAGTAGGCTGG No data
1003439717_1003439724 11 Left 1003439717 6:6128304-6128326 CCAAAATGCCTGTGTATAGTCTA No data
Right 1003439724 6:6128338-6128360 TACAAAGAGAAGTAGGCTGGGGG No data
1003439717_1003439720 4 Left 1003439717 6:6128304-6128326 CCAAAATGCCTGTGTATAGTCTA No data
Right 1003439720 6:6128331-6128353 CATCTAATACAAAGAGAAGTAGG No data
1003439717_1003439723 10 Left 1003439717 6:6128304-6128326 CCAAAATGCCTGTGTATAGTCTA No data
Right 1003439723 6:6128337-6128359 ATACAAAGAGAAGTAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003439717 Original CRISPR TAGACTATACACAGGCATTT TGG (reversed) Intergenic
No off target data available for this crispr