ID: 1003440805

View in Genome Browser
Species Human (GRCh38)
Location 6:6139835-6139857
Sequence AGGTATCACTTTAGAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003440805_1003440815 28 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440815 6:6139886-6139908 AAAAGGATGGATAGATGGCTTGG No data
1003440805_1003440814 23 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440814 6:6139881-6139903 GGAAAAAAAGGATGGATAGATGG No data
1003440805_1003440812 11 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440812 6:6139869-6139891 GGGTGGATTGTTGGAAAAAAAGG No data
1003440805_1003440809 -6 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440809 6:6139852-6139874 ATACCTGATGTGTGCACGGGTGG No data
1003440805_1003440813 15 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440813 6:6139873-6139895 GGATTGTTGGAAAAAAAGGATGG No data
1003440805_1003440808 -9 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440808 6:6139849-6139871 GTGATACCTGATGTGTGCACGGG No data
1003440805_1003440811 2 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440811 6:6139860-6139882 TGTGTGCACGGGTGGATTGTTGG No data
1003440805_1003440807 -10 Left 1003440805 6:6139835-6139857 CCCTGTTCTCTAAAGTGATACCT No data
Right 1003440807 6:6139848-6139870 AGTGATACCTGATGTGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003440805 Original CRISPR AGGTATCACTTTAGAGAACA GGG (reversed) Intergenic
No off target data available for this crispr