ID: 1003442031

View in Genome Browser
Species Human (GRCh38)
Location 6:6151788-6151810
Sequence AAACCTTGGGTTGGGGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 283}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003442031_1003442038 -1 Left 1003442031 6:6151788-6151810 CCGGTCTCCCCAACCCAAGGTTT 0: 1
1: 0
2: 0
3: 23
4: 283
Right 1003442038 6:6151810-6151832 TACCGGAACATCTTCTTCATTGG 0: 1
1: 0
2: 0
3: 7
4: 82
1003442031_1003442040 14 Left 1003442031 6:6151788-6151810 CCGGTCTCCCCAACCCAAGGTTT 0: 1
1: 0
2: 0
3: 23
4: 283
Right 1003442040 6:6151825-6151847 TTCATTGGTCTTGTTACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 126
1003442031_1003442041 24 Left 1003442031 6:6151788-6151810 CCGGTCTCCCCAACCCAAGGTTT 0: 1
1: 0
2: 0
3: 23
4: 283
Right 1003442041 6:6151835-6151857 TTGTTACTCCAGGACCATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003442031 Original CRISPR AAACCTTGGGTTGGGGAGAC CGG (reversed) Intronic
900678605 1:3903805-3903827 AAAACGTGGGTTGGGGAGCTGGG - Intergenic
902585301 1:17435518-17435540 AAACCTGGGGCCAGGGAGACTGG + Intronic
902635620 1:17733313-17733335 AGACTTTGGATTGGGGAAACTGG + Intergenic
903261971 1:22136394-22136416 GAACCTGGGGTTGGGGAAAGAGG + Intronic
904591698 1:31618522-31618544 TAACTTTGGGTTGGGAAAACGGG - Intronic
905834025 1:41101004-41101026 GAACCTGGGGTTGGGGAGGCGGG + Intronic
906232149 1:44172796-44172818 AAAGCTTCACTTGGGGAGACAGG + Intergenic
906369199 1:45237824-45237846 AAGCCTTTGGTGGGGGAGAAAGG + Intronic
906539274 1:46572555-46572577 AAAACTTGGGGTGGGGACATAGG + Intronic
907588220 1:55640610-55640632 AAAATTAGGGTTGGGGAGAGAGG - Intergenic
908075164 1:60509337-60509359 AAACCAAGGGTTGGTGAGATGGG - Intergenic
908811735 1:67988389-67988411 AAACCTTAGGCTGGGAAGAGGGG - Intergenic
908949073 1:69537408-69537430 AAAGCTAGGGTTGGGGAAAGAGG + Intergenic
909146343 1:71938072-71938094 AAACTTTGAGTTGGGAACACTGG - Intronic
909910065 1:81248272-81248294 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
909921429 1:81385574-81385596 AAACATTGTTTTGGGGAGAGTGG + Intronic
910637595 1:89426257-89426279 ATGCCTTGGGTAGGGGTGACAGG - Intergenic
910723086 1:90309252-90309274 AGAACTTGGGTTGGGGGCACTGG + Intergenic
912296574 1:108475770-108475792 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
914435300 1:147654168-147654190 AGTCCTGGGGTTGGGGAGCCTGG - Intronic
915795273 1:158724881-158724903 ATACATGGGGTTGTGGAGACGGG + Intergenic
918141292 1:181721957-181721979 AGAGCTTGGGTTGGTGGGACAGG + Intronic
918363527 1:183783194-183783216 AAACCTTGGGGTGAGGAGTGGGG + Intronic
918714301 1:187768386-187768408 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
919476502 1:198037614-198037636 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
919744887 1:201002470-201002492 AAACCTGGGGCAGGGGAGACTGG - Intronic
919909788 1:202103789-202103811 AAACCTTTGGTTGGTGAAACTGG + Intergenic
920829504 1:209451750-209451772 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
922467615 1:225854838-225854860 AAATCTAGAGTTGGGGAGATGGG + Intronic
922613679 1:226948020-226948042 GATCCTTGGGTTGGGGAGAGGGG - Intronic
923075310 1:230604051-230604073 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
923652239 1:235884485-235884507 AAACCATGGCTTTGGGAGACTGG - Intergenic
924608018 1:245551831-245551853 TAACCTGGGGTTGGGGAGGTTGG - Intronic
924745473 1:246829493-246829515 ACAATTTGGTTTGGGGAGACAGG - Intergenic
1064429571 10:15259077-15259099 AAACTGGGTGTTGGGGAGACTGG - Intronic
1067978719 10:51056567-51056589 AAGCCTAGGGTTAAGGAGACAGG - Intronic
1069852750 10:71421005-71421027 AAACCAAGGGTTGGGGGGAAAGG - Intronic
1069862932 10:71482510-71482532 ACACCTGAGGTTGGGGGGACAGG + Intronic
1069900000 10:71701751-71701773 AAACCCTGGATTTTGGAGACTGG - Intronic
1071795831 10:89004512-89004534 AAACAGTGGGTTGGGGGGAGGGG - Intronic
1071916301 10:90297827-90297849 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1072190539 10:93073635-93073657 ACACCTTGGATGGGGGAGGCGGG + Intronic
1073123011 10:101133415-101133437 AAAACTTAGGTTGGGGGCACTGG - Intronic
1073671349 10:105593710-105593732 AAACCCTGGGTTGGGGGGGTTGG - Intergenic
1075920413 10:126207227-126207249 AAACAATGGAATGGGGAGACAGG + Intronic
1076573175 10:131445814-131445836 ATAACATGGGGTGGGGAGACGGG + Intergenic
1077664879 11:4098884-4098906 TAACCTTGGATTGGGTAGCCAGG + Intronic
1080801842 11:35617586-35617608 CAACCTCGTGTTGGGGAGAGGGG - Intergenic
1081356914 11:42123409-42123431 AAGCTTTGGGTTGGGGAGAAGGG - Intergenic
1083033347 11:59614845-59614867 TAACCTTGAGTTTTGGAGACTGG + Intronic
1083647082 11:64178263-64178285 AAACCCTGGGGAGGGGAGATGGG - Intergenic
1084872566 11:72108128-72108150 AAAATCTGGGTTGGGGAGATGGG - Intronic
1086105431 11:83141820-83141842 AAAGCTTTGGTTGGGGAACCAGG + Intergenic
1088555054 11:111053017-111053039 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1089678189 11:120104608-120104630 AAACCTTGGTTCAGGGAGCCAGG - Intergenic
1090472922 11:126996144-126996166 AAATCTTCGGGTGGGGAAACTGG - Intronic
1091853360 12:3718992-3719014 AAACTTCAGGGTGGGGAGACTGG + Intronic
1092066733 12:5596445-5596467 AAAGGTTGGATTTGGGAGACAGG + Intronic
1092234214 12:6795958-6795980 ACAGCTTGGATTGGGGCGACTGG + Intronic
1092474587 12:8807755-8807777 AGGCTTTGGGTTGGGGAGAGGGG - Intergenic
1093578916 12:20766199-20766221 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1095197720 12:39341818-39341840 AAGCATTGTGTTGGGGAGTCAGG - Intronic
1095843574 12:46721335-46721357 ACACCTTGGGATGCCGAGACAGG + Intergenic
1096096029 12:48936355-48936377 AAACTTTGGGGTGGGGGGAGCGG + Exonic
1096741640 12:53697722-53697744 AATCCTTGGGTTTGGAAAACTGG + Intergenic
1097174864 12:57136638-57136660 CAGCCTTGGGTGGGGGAGAAGGG + Intronic
1097643500 12:62209054-62209076 AAACCTTGTGTTGGGGAAGTGGG - Intronic
1098141448 12:67453914-67453936 AGACCTTTGGTAGGGGAGAGGGG - Intergenic
1099891035 12:88588527-88588549 AAACTTTAGGGTGGGGAGAGGGG + Intergenic
1101854724 12:108432733-108432755 AAGCCTTGGCTGGGGGAGTCCGG - Intergenic
1102429183 12:112868411-112868433 ACACCTTGGGGAGGAGAGACAGG - Exonic
1103192491 12:119013930-119013952 ATACCCTGGGTTGGGAAGAAGGG - Intronic
1104031678 12:125069361-125069383 CAACCTTGGTCTGGGAAGACGGG - Intronic
1104698024 12:130879462-130879484 AAGCCTTCGCCTGGGGAGACAGG + Intergenic
1105032325 12:132892542-132892564 AGGCCTTGGGTTGGGAAGAAGGG - Intronic
1106184425 13:27396558-27396580 GAACCTGGGGTTGGGAAGAGAGG + Intergenic
1107087225 13:36438435-36438457 TAACCTGGGGTTGGGGGGGCAGG - Intronic
1109499392 13:63215944-63215966 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1109715803 13:66220385-66220407 GGACCTTGGGTTGGGGAGAGAGG - Intergenic
1110845437 13:80186501-80186523 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1110978585 13:81869010-81869032 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1112695769 13:101946107-101946129 TCACCTTGGGTTGGGGCAACAGG + Intronic
1116022666 14:39480791-39480813 AAAGCTTGGATTAGAGAGACTGG - Intergenic
1116534678 14:46015300-46015322 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1118837820 14:69488946-69488968 AATCCTTGGGTTAGGGAGATGGG + Intronic
1120463466 14:84826306-84826328 AAAGCTAGGGTTGGGGAGGTAGG - Intergenic
1120659858 14:87237919-87237941 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1121181842 14:91934988-91935010 AAACCATGGGGTGGGGTGAAGGG + Intronic
1122228961 14:100295551-100295573 AACTCTGGGGTTGGGGAGATGGG + Intronic
1122241975 14:100375201-100375223 AAACCTTGGTTTAGGGGGTCAGG - Intronic
1122678647 14:103438639-103438661 GAACCTTGAGTTTGGGAGATGGG + Intronic
1125485054 15:40105842-40105864 ACACCTTGGCTGGGGGAGGCTGG + Exonic
1126393867 15:48190989-48191011 CTAGCTTGTGTTGGGGAGACAGG + Intergenic
1126843845 15:52741411-52741433 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1128244540 15:66124173-66124195 CAACCTGGGGTCGGGGAGGCTGG - Intronic
1129026813 15:72583799-72583821 AAATCTTGGGATGGGGAAAGGGG + Exonic
1129538405 15:76332621-76332643 GAATCTGGGGTTGGGGAGGCAGG + Intergenic
1132244115 15:100281108-100281130 AGACGCTGGGTTGGGGATACGGG - Intronic
1132624634 16:886319-886341 AAGCCGTGGCTGGGGGAGACAGG - Intronic
1133559332 16:6935902-6935924 AACCCTTGGGTTTGTGTGACTGG + Intronic
1133651497 16:7817528-7817550 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1133766658 16:8842971-8842993 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
1134856248 16:17522029-17522051 AAACCTTTAGTTGTGGGGACTGG - Intergenic
1135810567 16:25583003-25583025 GAACCATGGGTTTGGGAGCCAGG + Intergenic
1136228870 16:28875679-28875701 AAACCTTGGCCTCAGGAGACTGG + Intergenic
1137398816 16:48136364-48136386 GCACACTGGGTTGGGGAGACTGG - Intronic
1139039137 16:62982025-62982047 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1139615048 16:68083959-68083981 AGACCTTGGGTCAGGAAGACAGG - Intergenic
1141865104 16:86744909-86744931 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1143318102 17:6047958-6047980 AGACTGTGGGTTGGGGCGACTGG + Intronic
1143544179 17:7586880-7586902 ACACCTAGGGGTGGGGAGACAGG - Exonic
1144099118 17:11928607-11928629 AAACGTTGGGAGGAGGAGACAGG + Intronic
1144443913 17:15309036-15309058 AAGCCTAGGGTTGGGGAGAGAGG - Intronic
1147313596 17:39608332-39608354 AGACCCCGGGTTGGGGAGAAAGG + Intronic
1149220599 17:54412287-54412309 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1152569315 17:81114746-81114768 AAACCCTGGGGTGGGCAGGCAGG - Intronic
1152666138 17:81570713-81570735 AAACCTTGGGATGGGATGGCTGG - Intronic
1153866349 18:9272955-9272977 AAACGTGGGGGTGGGGAGAATGG + Intronic
1153881625 18:9426160-9426182 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1154157061 18:11951952-11951974 AACCTTAGGGTTGGGGAAACAGG - Intergenic
1156437175 18:37144774-37144796 ACACTTTGGGATGTGGAGACAGG - Intronic
1157906292 18:51572914-51572936 AGACTTTGGGTTAGGGAGAAGGG + Intergenic
1159164571 18:64684459-64684481 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1160280746 18:77487899-77487921 GCAGCTTTGGTTGGGGAGACAGG + Intergenic
1161456460 19:4372151-4372173 AAAGCATGGGTTGGGGAGCTGGG + Intronic
1161527436 19:4765514-4765536 AAACCTTGGGGTTGGCAGACTGG + Intergenic
1161661829 19:5551306-5551328 AAGCTTTGGGCTGGGGAGAAGGG - Intergenic
1163190364 19:15672940-15672962 AAACCTGGGGTTGGGCCCACTGG - Exonic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167902246 19:52630602-52630624 AAGCTTTGGGTTGGGGAGAAGGG - Intronic
1168366612 19:55793320-55793342 GCACCTTGGGAGGGGGAGACAGG + Intronic
926463989 2:13166872-13166894 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
928779611 2:34803844-34803866 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
928928666 2:36601867-36601889 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
929792966 2:45037315-45037337 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
930098978 2:47588545-47588567 AAGCTTTGGGTTGGGGAGAAGGG + Intergenic
931260714 2:60616034-60616056 GAACCTGGGGTTGGTGATACTGG - Intergenic
931670459 2:64642710-64642732 AGACCCTGGGTTGGGGGGGCAGG + Intronic
931933320 2:67166226-67166248 TTATCTTGGGTTTGGGAGACAGG + Intergenic
931933996 2:67175236-67175258 AATCTTGGGGTTGGGGGGACAGG + Intergenic
932009956 2:67965634-67965656 AAATCCTGGGTTGGGGAGTAAGG + Intergenic
932615377 2:73228118-73228140 AGACCCTGGGTAGGGGAGGCTGG + Exonic
933117880 2:78497609-78497631 AAGCCTTGGGATGGGGAGTGTGG - Intergenic
933329416 2:80877346-80877368 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
936284237 2:111168948-111168970 AAAGCCTGGTTTGGGGATACAGG + Intergenic
937172324 2:119887240-119887262 ACACCTTGGGATGGCGAGGCAGG + Intronic
937863613 2:126731993-126732015 AATACTTGGGTTGGGGTGGCAGG - Intergenic
940212526 2:151270011-151270033 AAACCTTGGCATGGAGAGAGAGG - Intergenic
941456092 2:165713380-165713402 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
943844848 2:192633175-192633197 AAGCCGGGGGGTGGGGAGACTGG - Intergenic
944708186 2:202311907-202311929 CAATTTTGGGGTGGGGAGACGGG - Intergenic
944883768 2:204042245-204042267 AAGACTTGGGTTGGGGAGGGCGG + Intergenic
945301392 2:208219115-208219137 AGGCATTGGGTTGGGGAGAAGGG + Intergenic
945473249 2:210251529-210251551 AAGCCTTGGGTAGGGGAGTGTGG - Intergenic
945858220 2:215092415-215092437 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
946127194 2:217573362-217573384 AAAACTTGGGCTTGGCAGACAGG - Intronic
1169538587 20:6575382-6575404 ATGCCTTAGGTTGGGGAGATGGG + Intergenic
1171366531 20:24628679-24628701 AACCCTTGGGGAGGGGAGTCTGG + Intronic
1172409695 20:34711879-34711901 AAACCTAGAGTTGGGGTGAGGGG - Exonic
1172932366 20:38595591-38595613 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1173763676 20:45587076-45587098 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1173781835 20:45762629-45762651 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
1173801858 20:45899059-45899081 AATCCCTGTGTTGGGGAGAGGGG + Exonic
1174183095 20:48687200-48687222 AAATCTTGACTTGGGGAGAAAGG - Intronic
1174254374 20:49243349-49243371 CAACCTTGGGCTGGGGAAAATGG - Intronic
1174386184 20:50189900-50189922 AAGCCTTAGGTTTGGGAGTCTGG + Intergenic
1174639563 20:52031757-52031779 CAACCTTGAGTTGGGGAGGAGGG + Intergenic
1174999830 20:55615199-55615221 AAAGCTTGGGTTGTAGAGGCAGG - Intergenic
1175155287 20:56967259-56967281 AACCACTGGGCTGGGGAGACTGG - Intergenic
1181265958 22:21630678-21630700 AAAAGTTGGGTTGGGGAGAAAGG - Intergenic
1181269051 22:21648178-21648200 AAGCCTTGGGGTGGGGTGAGGGG + Intergenic
949161994 3:893547-893569 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
949190293 3:1242686-1242708 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
952768654 3:36977152-36977174 AGACCCTGGGTAGGGGAGGCTGG - Intergenic
952851818 3:37735659-37735681 AACCCTTGGGTAGGGGTCACAGG - Intronic
953177301 3:40563808-40563830 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
954280150 3:49571453-49571475 TAGACTGGGGTTGGGGAGACGGG + Intronic
956386836 3:68728632-68728654 AAACTTTCGGCTGGGGAGAAGGG + Intergenic
956457726 3:69440155-69440177 AAACCTTTAGATGGGGAGAAAGG - Intronic
958830898 3:99087973-99087995 AAATGTTGGGTTTGGGAGTCGGG + Intergenic
961164665 3:124755437-124755459 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
961177821 3:124850537-124850559 AAACCATGGGGTGGGGGGAGGGG + Intronic
961640946 3:128364535-128364557 AGACCATGGGATGGGGAGTCGGG + Intronic
962010359 3:131385340-131385362 AAATCTAGGGTTGGCGAGGCTGG + Intronic
962205668 3:133431948-133431970 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
962330873 3:134476743-134476765 GAGCCTTTAGTTGGGGAGACAGG - Intergenic
963058722 3:141207799-141207821 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
963456566 3:145554063-145554085 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
963715021 3:148793396-148793418 AAACTTTGGGATGGTGAGGCAGG + Intronic
963842993 3:150127123-150127145 AAACTTTAGGCTGGGGAGAGGGG + Intergenic
965335200 3:167425427-167425449 AGACTTTGGGTTGGGAAGAAGGG - Intergenic
965639942 3:170820842-170820864 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
965713513 3:171579249-171579271 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
966232754 3:177668728-177668750 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
966757238 3:183382971-183382993 AAACCTTGTGTAGAGGAGAAAGG - Intronic
966777649 3:183556920-183556942 AATCCAGGGGGTGGGGAGACTGG + Intergenic
967658011 3:192073965-192073987 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
968535653 4:1126782-1126804 AAACTTTGGGATGGGAAGAGCGG - Intergenic
969097769 4:4746907-4746929 AGACCTAGGGGTAGGGAGACAGG + Intergenic
969653990 4:8485657-8485679 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
970163522 4:13213022-13213044 AACCCCTGGGCTTGGGAGACAGG - Intergenic
976478977 4:85516997-85517019 AAAACTGAGGTTGGGGAAACTGG - Intronic
977062408 4:92274381-92274403 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
977662403 4:99605848-99605870 ATACATGGGGTTGGGGAGAATGG - Intronic
978011739 4:103694510-103694532 AAACTTTAGGTTGGGGAGAGGGG - Intronic
978089247 4:104693264-104693286 AAACATTAGGTGTGGGAGACAGG + Intergenic
980111828 4:128643746-128643768 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
980575531 4:134680791-134680813 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
981525308 4:145701920-145701942 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
981908573 4:149952446-149952468 AATCCTTTGGGTTGGGAGACTGG - Intergenic
982318907 4:154059105-154059127 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
982396632 4:154921723-154921745 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
982497012 4:156106360-156106382 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
983023973 4:162711929-162711951 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
984700771 4:182817350-182817372 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
985081267 4:186266798-186266820 AAAAATTGGGGTGGGGAGAGCGG + Intronic
985581033 5:695193-695215 AAACTTTGGCTTGGGGTCACGGG + Intergenic
985595658 5:786525-786547 AAACTTTGGCTTGGGGTCACGGG + Intergenic
987149615 5:15025599-15025621 AATGCTTGGGTTGGAAAGACTGG - Intergenic
987479556 5:18436240-18436262 AAAAATTAGGTTGGGGAAACTGG + Intergenic
990676014 5:58185686-58185708 AAATCTTGGGTTCAGGAGGCAGG - Intergenic
995135935 5:108679730-108679752 AAACCTTGGGGAGGAGAGCCTGG - Intergenic
995899272 5:117049256-117049278 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
996566185 5:124881607-124881629 AAACCTGGGGCTGGGCAGATTGG - Intergenic
997607613 5:135186386-135186408 CAACCTTGGGGTGGGATGACAGG - Intronic
998352825 5:141512333-141512355 AGTCCCTGGGTTGGGGAGGCAGG + Exonic
1001331353 5:170764925-170764947 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
1001589519 5:172855796-172855818 ACGCCTTGTGTTGGGGAGCCAGG + Intronic
1002610855 5:180417606-180417628 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1002981149 6:2140145-2140167 GGACCTTGCGTTGGGGAGACTGG + Intronic
1002991255 6:2241112-2241134 ACAGCATGGTTTGGGGAGACAGG + Intronic
1003442031 6:6151788-6151810 AAACCTTGGGTTGGGGAGACCGG - Intronic
1003972422 6:11312119-11312141 AATGCTTGGGCTGGAGAGACAGG - Intronic
1004496303 6:16166294-16166316 AAACCTTGAGAAGGGGAGAAGGG - Intergenic
1005386899 6:25294007-25294029 AAACCTTGGGTTGGGCACAGTGG - Intronic
1005822695 6:29610742-29610764 AAGGCGTGGGTAGGGGAGACTGG - Intronic
1006947526 6:37794918-37794940 AGACATTGGGGTGGGGAGAGAGG - Intergenic
1007660152 6:43479275-43479297 AAGCCTTTGATTGGGGGGACAGG - Intronic
1007716851 6:43861794-43861816 TGGCCTTGGGTTGGGGACACTGG - Intergenic
1007797307 6:44360212-44360234 AAACCTTGGGAGGCTGAGACAGG - Intronic
1007929376 6:45676631-45676653 AAACCACGGGTTGGGGTGAGGGG + Intergenic
1010060159 6:71613547-71613569 AAACCTTGGGGTGGGAAGGAGGG - Intergenic
1012689673 6:102295758-102295780 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1014558001 6:122856466-122856488 AATCCCTGGGGTGGGGAGAGGGG + Intergenic
1015165316 6:130195170-130195192 AGGCTTTGGGTTGGGGAGAAGGG - Intronic
1015442374 6:133263892-133263914 AGACCTTGGGATGGGGAAACAGG - Intronic
1016114045 6:140260327-140260349 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1016634354 6:146270577-146270599 AAACCTTGGGTTGGGGGTCATGG - Intronic
1018229573 6:161662715-161662737 AAACCTTGGGTTTCAGATACAGG - Intronic
1018521374 6:164655037-164655059 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1018686792 6:166309507-166309529 AGAGCTTGGGTTGGGGTGACAGG + Intergenic
1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG + Intronic
1022129484 7:27391333-27391355 AGACCTAGGGTTGGGGAAACAGG + Intergenic
1022372971 7:29787668-29787690 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1022473031 7:30693325-30693347 ACACCTTGGGGAAGGGAGACGGG + Intronic
1026930573 7:74220940-74220962 TAACCCTGGGTTTGGGGGACTGG + Intronic
1029834595 7:103296248-103296270 AAGGCCTGGGTTGGGCAGACAGG + Intergenic
1032711192 7:134461924-134461946 AAACCTTGGGTTGGGACAGCAGG - Intergenic
1032723230 7:134567941-134567963 AAGCCTTGGTTTGGAGAAACTGG + Intronic
1034513343 7:151553749-151553771 ACAGCTTGGGGTGGGGAGAGGGG - Intergenic
1034629927 7:152523018-152523040 AAACTGGGGGTGGGGGAGACTGG - Intergenic
1035357579 7:158285782-158285804 AGTCCTTGGGTTAGGGAGACAGG + Intronic
1035663643 8:1364701-1364723 AAAGCTTGCGTGGGGGAGACAGG + Intergenic
1036549764 8:9805771-9805793 AGGCTTTGGGTTGGGGAGAATGG - Intergenic
1037494340 8:19424358-19424380 AAGCCTTGGGTTGAGGAATCAGG - Intronic
1039414947 8:37385881-37385903 TAAACGGGGGTTGGGGAGACGGG - Intergenic
1043353570 8:79388985-79389007 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1043837824 8:85065799-85065821 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1044417188 8:91950790-91950812 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1048382059 8:133874053-133874075 AGAGCTTGGGTTGGGGGGAGTGG + Intergenic
1048991822 8:139765051-139765073 AAGCGTTGGCTTGGAGAGACTGG - Intronic
1049575309 8:143387053-143387075 TGACCTCGGGTTGGGGAGAGTGG - Intergenic
1049921512 9:369203-369225 ACACCTTGCATTGGGAAGACAGG - Intronic
1052259996 9:26503608-26503630 AAATCTTTAGTTGGGGAGAGAGG + Intergenic
1052653432 9:31329238-31329260 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1052720551 9:32167409-32167431 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1053538559 9:38949804-38949826 AAACTTTAGGCTGGGGAGAAAGG - Intergenic
1053729231 9:41035654-41035676 AAACCATGGCTAGGGGAGGCTGG - Intergenic
1054627579 9:67414115-67414137 AAACTTTAGGCTGGGGAGAAAGG + Intergenic
1054699282 9:68396412-68396434 AAACCATGGCTAGGGGAGGCTGG + Intronic
1057004743 9:91547277-91547299 GAACCTGAGGTTGTGGAGACAGG + Intergenic
1057888797 9:98852465-98852487 AAACGGTGGGGAGGGGAGACAGG - Intergenic
1057982184 9:99672990-99673012 ACGCTTTGGGTTGGGGAGAAGGG - Intergenic
1058612492 9:106791028-106791050 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1059574711 9:115476176-115476198 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1060226307 9:121793156-121793178 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1061673130 9:132200513-132200535 ACATCATGGGTTGGGGAGAAAGG + Intronic
1062076055 9:134590592-134590614 AAGCCTGGAGCTGGGGAGACAGG + Intergenic
1186112757 X:6275065-6275087 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1186769183 X:12800797-12800819 AAACCATGTCTTGAGGAGACTGG - Intronic
1187346905 X:18473837-18473859 AGACCTGGGGGTGGGGAGAGGGG + Intronic
1187512486 X:19934020-19934042 ACACTTTGGGTTGCTGAGACGGG - Intronic
1187937260 X:24347992-24348014 AATCCTTCGGTTGGAGAGACTGG + Intergenic
1188736073 X:33717989-33718011 AAATATTGGGGTGGGGGGACGGG - Intergenic
1189775008 X:44462689-44462711 AAACCTAGAGATGGGGAGAGAGG - Intergenic
1190322461 X:49186997-49187019 AAGACTTGGGGTGGGGGGACGGG - Intergenic
1191761380 X:64651741-64651763 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1191970059 X:66803807-66803829 AAATGTTGGGTTGGGAAAACTGG + Intergenic
1192434280 X:71133272-71133294 AAGCCTCAGGTTGGGGAGAATGG + Intronic
1193886024 X:86984628-86984650 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic
1194293524 X:92103124-92103146 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
1195444378 X:104934901-104934923 AAACCTTGTGCTGCGGAGTCAGG + Intronic
1196220888 X:113111600-113111622 AGGCTTTGGGTTGGGGAGAAGGG + Intergenic
1197303734 X:124814521-124814543 AAACCTTGGAATGGGGAGCTAGG - Intronic
1200611044 Y:5327670-5327692 AGGCTTTGGGTTGGGGAGAAGGG + Intronic
1201937227 Y:19421800-19421822 AGGCTTTGGGTTGGGGAGAAGGG - Intergenic