ID: 1003442349

View in Genome Browser
Species Human (GRCh38)
Location 6:6154933-6154955
Sequence CATACCATGGAGAAGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003442349_1003442353 -8 Left 1003442349 6:6154933-6154955 CCATCTGTCTTCTCCATGGTATG 0: 1
1: 1
2: 1
3: 25
4: 245
Right 1003442353 6:6154948-6154970 ATGGTATGCTATATAAGGATGGG No data
1003442349_1003442352 -9 Left 1003442349 6:6154933-6154955 CCATCTGTCTTCTCCATGGTATG 0: 1
1: 1
2: 1
3: 25
4: 245
Right 1003442352 6:6154947-6154969 CATGGTATGCTATATAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003442349 Original CRISPR CATACCATGGAGAAGACAGA TGG (reversed) Intronic
902557101 1:17253439-17253461 CAGCACATGGAAAAGACAGAAGG + Intronic
904468516 1:30721946-30721968 CAGCCCATGGGGAACACAGAGGG + Intronic
904935549 1:34127408-34127430 CATATCACAAAGAAGACAGATGG + Intronic
905337634 1:37256417-37256439 GACACCATGAGGAAGACAGATGG - Intergenic
905682212 1:39882149-39882171 CATATCTTGGAAAAGACAGCTGG + Intronic
907241778 1:53085006-53085028 CGTTCCCTGGAGAAGACACAAGG + Exonic
908211284 1:61903004-61903026 CATAGCATGAACAAGCCAGAAGG + Intronic
908253206 1:62281548-62281570 CCAAAGATGGAGAAGACAGATGG - Exonic
908703698 1:66928487-66928509 TATACCATGGAGATGAAGGAGGG - Intronic
909498702 1:76309475-76309497 AAAACCATGGATGAGACAGAAGG - Intronic
910017843 1:82549454-82549476 CATACAAAAGAGAAAACAGAAGG + Intergenic
911032126 1:93500407-93500429 CATATCCTGGAGAAGAATGATGG + Intronic
911527890 1:99007296-99007318 CATTTAAAGGAGAAGACAGAAGG - Intergenic
914876034 1:151513181-151513203 CACACCACGGAGGAGGCAGAGGG - Intronic
916754403 1:167754931-167754953 GAGGCCATGGAGGAGACAGATGG - Intronic
918192812 1:182192367-182192389 GAAACCAATGAGAAGACAGAAGG + Intergenic
918847843 1:189641792-189641814 CATCCCATGAAGAAGGTAGAAGG + Intergenic
920624620 1:207585006-207585028 CATACCATAGCTAAAACAGATGG + Intronic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
920883261 1:209899748-209899770 ATTACCATGGGGAAGACTGAAGG - Intergenic
922386339 1:225087616-225087638 CAGACCTTGGAGAAGGAAGATGG + Intronic
922972163 1:229751745-229751767 CAAAGCCTGGAGAAGGCAGAGGG - Intergenic
924067681 1:240242333-240242355 GAAACAATGGAGAAGTCAGATGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924798241 1:247308548-247308570 CATTCCAGGTAGAAGAAAGAAGG - Exonic
1063656137 10:7990948-7990970 CAGAACCTGGAGGAGACAGAGGG + Intronic
1064790011 10:18947295-18947317 AATACCATGGAGAAAATACAGGG - Intergenic
1065699938 10:28414946-28414968 CTAACCGTGGAGAAGACAGAAGG + Intergenic
1066041878 10:31556728-31556750 CACACCATGGAAAATACAGGGGG + Intergenic
1066323281 10:34327289-34327311 CACAACATGGAGAGGCCAGATGG + Intronic
1066543077 10:36470129-36470151 TTTACCATGGAGAAGAATGAGGG + Intergenic
1068080991 10:52316532-52316554 CCTACGAAGGAGAAGACAGTAGG - Exonic
1069351548 10:67532695-67532717 GATACCAAGGAGAAGAAAGATGG + Intronic
1069690394 10:70348073-70348095 CACATAATGGAGAAAACAGATGG - Intronic
1069854937 10:71434908-71434930 CATGCCAAGAAGAAGGCAGATGG - Intronic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1071868699 10:89767449-89767471 CATGACAGGGAAAAGACAGATGG - Intronic
1073522420 10:104145894-104145916 AATAGCATAAAGAAGACAGATGG - Intronic
1074880277 10:117651368-117651390 CATACCAGTGTGATGACAGAGGG + Intergenic
1075548842 10:123377075-123377097 CATGCCATGAAGGAGACACACGG - Intergenic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1077323663 11:1953963-1953985 CATGCCATGACAAAGACAGATGG - Intronic
1078892064 11:15566530-15566552 CCTACCATGAAGGAGAAAGAGGG - Intergenic
1080041828 11:27767437-27767459 AGGACCATGGAGAACACAGAAGG - Intergenic
1081341052 11:41928214-41928236 CATACCTTGGAGAAGACAAGGGG - Intergenic
1081522127 11:43892411-43892433 CATACCAGGGTGTACACAGAAGG - Intronic
1084998459 11:73006672-73006694 CATAGTAGGGAGAATACAGAGGG - Intronic
1089933201 11:122335177-122335199 CATGCCAAGGAAAACACAGACGG + Intergenic
1090981671 11:131727849-131727871 TAAAACATGCAGAAGACAGAGGG - Intronic
1202806650 11_KI270721v1_random:9158-9180 CATGCCATGACAAAGACAGATGG - Intergenic
1091572934 12:1706205-1706227 CTTACCAATGAGAAGACTGAGGG - Intronic
1091671779 12:2457208-2457230 GATACCATGGAGAAGCCGGAGGG + Intronic
1091820695 12:3473319-3473341 CATCCCATGGAGAAGCCTGGAGG - Intronic
1092891334 12:12971938-12971960 CATACAATGGAGAACAAAGCAGG + Intergenic
1092963852 12:13622699-13622721 CATCCCACGCAGAAGGCAGAAGG + Intronic
1093983979 12:25507608-25507630 CATGCCATAGAGAAGGCACAGGG + Intronic
1095143283 12:38693165-38693187 CATAACATGGAGAAGATCTAAGG + Intronic
1095634939 12:44421826-44421848 TATTCCAGGAAGAAGACAGAGGG - Intergenic
1097268015 12:57756708-57756730 CATACCAAAGAGATGAAAGATGG - Intronic
1098063541 12:66587794-66587816 CATTCCGTGCAGAAGGCAGAGGG + Intronic
1100123696 12:91397740-91397762 CATCCCATGGAGAAGGCAGAAGG + Intergenic
1101867570 12:108532221-108532243 CTCACCATGGAGAGGACAGAAGG - Exonic
1102949383 12:117019821-117019843 ATTACCTTGGAGAAGAAAGAGGG - Intronic
1104336932 12:127907091-127907113 AATACCAGGGAGCAGAGAGATGG + Intergenic
1108346582 13:49552281-49552303 TATACCTTAGAGAGGACAGAAGG + Exonic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108574397 13:51779025-51779047 CATACAATGTGGAAAACAGATGG + Intronic
1108574672 13:51781186-51781208 CATTACCTGGAGAAGACAGCAGG + Intronic
1108594501 13:51937940-51937962 CAGCACATGGAGAAGACAGTTGG - Intronic
1108756871 13:53513610-53513632 CACCCCATGGAGCAGACAGCTGG - Intergenic
1108898766 13:55370230-55370252 TCTACCATGGTGAAGAAAGAAGG - Intergenic
1110532230 13:76610615-76610637 CATATCATGGAGAAGCCAAATGG - Intergenic
1111850597 13:93568527-93568549 CATACCATGAGGAACAAAGAGGG + Intronic
1112381744 13:98897330-98897352 CAAACCCTTGAGAAGAAAGATGG - Intronic
1113448625 13:110389563-110389585 TAGACCATAGGGAAGACAGAGGG - Intronic
1114791755 14:25667471-25667493 CATACCATGGAGGTGACTGATGG - Intergenic
1115730350 14:36262011-36262033 AATACCATGCAGAAGATAGTGGG - Intergenic
1115971789 14:38952903-38952925 CAGAACATGGAGGAGACACAGGG + Intergenic
1117940971 14:60964291-60964313 CAGACCTTGGAGAAGAGGGAGGG - Intronic
1118162838 14:63308193-63308215 CTTACCATGGAGGAGACTGAGGG - Intergenic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1118876560 14:69789971-69789993 CAGACCAGGGAAAAGAGAGATGG + Intronic
1120043691 14:79782226-79782248 CATACCACAGAGGAGAGAGAGGG - Intronic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1123166362 14:106329099-106329121 CATAAGATGGAGAAGACAACTGG + Intergenic
1125749891 15:42020959-42020981 CATGCCAAGCAGAAGACAGCAGG - Intronic
1125791486 15:42369794-42369816 CATAAGATTGAGAGGACAGATGG + Intronic
1126191426 15:45882949-45882971 GATACCTGGGAGAAGACAAAGGG - Intergenic
1126656071 15:50979423-50979445 TACATCATGAAGAAGACAGAAGG - Intronic
1127645739 15:60957142-60957164 AAGACGATGGAGGAGACAGACGG + Intronic
1128585212 15:68843261-68843283 CAGACGAGGGAGAACACAGATGG + Intronic
1129392285 15:75226433-75226455 CACACCCTGGGGAAGGCAGAGGG - Intergenic
1129908263 15:79205180-79205202 GAGACCAGGGAGGAGACAGACGG + Intergenic
1130576181 15:85095117-85095139 CATAGCTTGTAGCAGACAGAAGG + Intronic
1132189435 15:99838663-99838685 AATACCATGGTGAACACAAAGGG - Intergenic
1132415350 15:101615233-101615255 CCTACCATGGGGAATGCAGAAGG + Intergenic
1133865252 16:9636269-9636291 AAGACCATGAGGAAGACAGAAGG - Intergenic
1135904958 16:26503147-26503169 GATACAATGTAGAATACAGATGG - Intergenic
1137509931 16:49090299-49090321 CATAACATGTAGCACACAGAAGG - Intergenic
1137893376 16:52185299-52185321 CAAACCATGGAGTAGAGAGCAGG - Intergenic
1137903363 16:52293482-52293504 CACATCATGGAGAAGAGAGGGGG - Intergenic
1139544249 16:67642130-67642152 CATGCCATCCAGAACACAGACGG + Intergenic
1141341505 16:83208185-83208207 CATACCCTGGTGAAGAAACATGG - Intronic
1143415911 17:6749971-6749993 TCTGCCATGAAGAAGACAGAAGG + Intergenic
1144890422 17:18491084-18491106 AGGACCCTGGAGAAGACAGATGG - Intronic
1145141794 17:20453234-20453256 AGAACCCTGGAGAAGACAGATGG + Intronic
1145794116 17:27645656-27645678 AGAACCCTGGAGAAGACAGATGG - Intronic
1145808918 17:27753197-27753219 AGAACCCTGGAGAAGACAGATGG - Intergenic
1149376317 17:56047613-56047635 GATACCTTGTAGAAGACAGATGG - Intergenic
1152501999 17:80718392-80718414 CTTATCATGGAGAGCACAGACGG + Intronic
1153483200 18:5568385-5568407 GAAACCATAGAGAAGAGAGAAGG - Intronic
1153706868 18:7754798-7754820 GCTACCAGGGAGCAGACAGAGGG - Intronic
1157179855 18:45487499-45487521 CCTACCATGGGGAGGAAAGATGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1159200357 18:65175498-65175520 CATAACATGGAAAAGCAAGATGG - Intergenic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159892953 18:73969785-73969807 CACACCATGAGGAAGACAAAGGG + Intergenic
1160616172 18:80130919-80130941 CCAACCATGGATAAGACAGATGG - Intronic
1164573290 19:29389535-29389557 CATGCCTTGGAGAAGCCAGCAGG - Intergenic
1165874009 19:38992948-38992970 CATACTATGGAGACCACACAGGG + Intronic
1167692735 19:50996763-50996785 CAATCCAGGGAGAAGACAGTAGG + Intronic
925411271 2:3641182-3641204 GATACCAGGGAGAAAAGAGAGGG + Intronic
926493153 2:13550442-13550464 CATACAACCTAGAAGACAGAAGG - Intergenic
926760767 2:16277063-16277085 AAAACCATGCAGAAGCCAGAGGG + Intergenic
927868172 2:26606365-26606387 GAAACCAGGAAGAAGACAGAGGG + Intronic
928811392 2:35232081-35232103 CAAACCATTGCCAAGACAGAAGG + Intergenic
930222242 2:48756320-48756342 CTTACCATGTAGAAGCCAGAAGG - Intronic
930232150 2:48854139-48854161 ATTACCAAGGAGAAGACAGGTGG + Intergenic
931234240 2:60399896-60399918 GGCACCATGGAGAAGACTGAAGG + Intergenic
934048539 2:88191146-88191168 CACACCCTGGAGAAGGCACAGGG + Intergenic
934750301 2:96789545-96789567 CAAAGCCTGGAGAAGACAGTGGG + Intronic
935830902 2:106999874-106999896 CAGACTTTGGAGAAGAGAGACGG + Intergenic
937291751 2:120786010-120786032 CATAAGAGGGAGAAGACAGAGGG + Intronic
937400528 2:121579216-121579238 TTTACTATGAAGAAGACAGAGGG + Intronic
940718755 2:157258497-157258519 CCTAACAAGCAGAAGACAGACGG + Exonic
942339887 2:174932750-174932772 CATAGCAGGAGGAAGACAGAGGG - Intronic
942795873 2:179818758-179818780 CTTTCCATTGAGTAGACAGACGG - Intronic
944224791 2:197338892-197338914 AATACCAGGCAGAAAACAGAGGG - Intergenic
945570378 2:211459671-211459693 CATATCATGCAGAAGGCAAAAGG - Intronic
1169002514 20:2178164-2178186 CATACCTGGAACAAGACAGAAGG - Intergenic
1169289259 20:4334766-4334788 CATAACCTGGATCAGACAGAAGG + Intergenic
1172344778 20:34189563-34189585 CAAACCCTGGAGAAGCCACACGG + Intergenic
1173114555 20:40228381-40228403 CTGCCCATGGAGAAGACTGAGGG - Intergenic
1174651537 20:52129834-52129856 CATACCATGGTGGTGACACAGGG - Intronic
1175284069 20:57825907-57825929 CATGCAGTGGAAAAGACAGAGGG + Intergenic
1175446446 20:59023583-59023605 CATACCATGGACAAAACTGTCGG - Exonic
1176974497 21:15304314-15304336 CATAACATAAAGAAGACAAAAGG + Intergenic
1178632741 21:34276973-34276995 CATTCCATGGAGACACCAGATGG + Intergenic
1181324150 22:22032108-22032130 CAGCCCAGGGAGAAGAAAGAGGG + Intergenic
1181742110 22:24929465-24929487 CAGGCCTTGGAGAGGACAGAGGG - Intergenic
1181820145 22:25469073-25469095 AATCCCATGCAGAAGTCAGAGGG + Intergenic
1183473982 22:38025889-38025911 CATCCCATGTAGAAGACAGGAGG - Intronic
949467482 3:4358854-4358876 TACACCTTGGAGAAGAAAGAAGG + Intronic
950172664 3:10850451-10850473 CTTACCATGGGGTAGAAAGATGG + Intronic
950179377 3:10900601-10900623 CATGCCCTGGAGAAGCCAAAAGG - Intronic
950610204 3:14121975-14121997 CATCCAGTGGAGAAGACGGAAGG + Exonic
951619366 3:24584146-24584168 CAACCCATGGGAAAGACAGAGGG + Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955469963 3:59276322-59276344 CAAAACCTGGAGAAGACAGAAGG + Intergenic
955500625 3:59579152-59579174 CAGCCCAGGGAGAATACAGATGG + Intergenic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956558022 3:70542939-70542961 AATACCATGGAGAAGTCTGGGGG + Intergenic
958131697 3:89434638-89434660 CATACTCTGGAGAACACAGGGGG + Intronic
958461142 3:94397511-94397533 CTTCACATGGTGAAGACAGAAGG - Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
960401268 3:117202049-117202071 CATGCCATAGAAAAGACTGAAGG + Intergenic
961341789 3:126228307-126228329 CATACCAAGGATGAGACAGTGGG + Intergenic
962072664 3:132047766-132047788 CATACTATCCAGAAGACAGCTGG - Intronic
963017502 3:140839839-140839861 CAGCCCAGGGAGAAGGCAGAGGG - Intergenic
965023979 3:163274263-163274285 CTCCCCATGAAGAAGACAGAAGG - Intergenic
969619563 4:8272307-8272329 CAGACCATCGAGGGGACAGAAGG + Intronic
970640879 4:18064658-18064680 CATACCATGGGGAAGGAAGGAGG - Intergenic
971015455 4:22484646-22484668 GATACCATGCAGAATACAAATGG + Intronic
971360885 4:25937386-25937408 CATCCCATGGTGAAGGCAAAAGG + Intergenic
974186143 4:58449336-58449358 GATACTATGGAGACGCCAGAAGG - Intergenic
978478015 4:109154328-109154350 CATAAACTGTAGAAGACAGATGG - Intronic
980537866 4:134152585-134152607 AATACCATGTGGAAGACAGAGGG + Intergenic
981551236 4:145943599-145943621 CATACCCTGGGAAAGAGAGAGGG - Intergenic
981587082 4:146315312-146315334 CATATAATAGAGAAGACTGAAGG - Intronic
981675683 4:147340249-147340271 CATCCCATAGAGAGGACAGAAGG - Intergenic
982383836 4:154779004-154779026 CATACAAGGGAGAAAATAGAAGG - Intergenic
984365963 4:178800602-178800624 CATAATATGAAGAAGACAGATGG - Intergenic
986208108 5:5645213-5645235 TATAACATGGAGAACACATAGGG - Intergenic
987296629 5:16558328-16558350 CATCCCATGGTGAAGATGGAAGG - Intronic
988932702 5:36052569-36052591 CCTACCAGGGATAAGAGAGAAGG - Intronic
990754414 5:59052493-59052515 GATAGAATGGAGAAGAGAGAAGG + Intronic
991601164 5:68352638-68352660 CATACATAGGAGCAGACAGATGG + Intergenic
993261823 5:85667356-85667378 CAGACTATGAAGAAAACAGAAGG + Intergenic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
1003210385 6:4058960-4058982 CAGACCATGGAAAAGATGGAGGG + Intronic
1003442349 6:6154933-6154955 CATACCATGGAGAAGACAGATGG - Intronic
1005528816 6:26681033-26681055 CCTGGCATGGAGAAAACAGATGG - Intergenic
1005541980 6:26820615-26820637 CCTGGCATGGAGAAAACAGATGG + Intergenic
1006149493 6:31979107-31979129 CATCCCATGGAGAGGGCACAGGG + Intronic
1006171810 6:32097409-32097431 CACACCATGGAGACTGCAGAGGG + Intronic
1011191911 6:84738346-84738368 CATACCATGCAGAAGACAGATGG + Intronic
1012872937 6:104693418-104693440 CAATCCCTCGAGAAGACAGAGGG - Intergenic
1012926741 6:105274966-105274988 TATTCCAGGGAGGAGACAGATGG - Intergenic
1013029632 6:106320756-106320778 CATACCAAACAGAAGACTGAGGG + Intronic
1013142976 6:107358539-107358561 CATTCTATGGAGAATAAAGATGG + Intronic
1013663379 6:112321964-112321986 CATCCCATGGAGAAAATGGATGG - Intergenic
1014733719 6:125066661-125066683 AATACCATGGAGAAAAAATAAGG - Intronic
1014930194 6:127326274-127326296 CTTACCATGGTGGAGCCAGAGGG - Intronic
1015113857 6:129623720-129623742 CATACCTTCTAGAAGACAAACGG + Intronic
1015851493 6:137577975-137577997 CATCCCATGGACAGGAGAGATGG - Intergenic
1017038443 6:150288085-150288107 CTTGCCATGCAGAACACAGAAGG + Intergenic
1017161100 6:151366666-151366688 CATACAATGAAGAAGCCAGTGGG + Exonic
1017757772 6:157544128-157544150 CATATCATTGAGGAGAGAGAGGG + Intronic
1017970330 6:159306832-159306854 GCTACAATGGAGAAGAAAGAGGG - Intergenic
1019556638 7:1634764-1634786 CAGCCCATGGAGAGGACACATGG - Intergenic
1019754898 7:2761899-2761921 CATTCCGTGGATACGACAGATGG - Intronic
1020142985 7:5622568-5622590 TATGCCATGGACAAGGCAGAAGG + Intronic
1020982201 7:15084982-15085004 CCTACCAGAGAAAAGACAGAGGG + Intergenic
1021694893 7:23267054-23267076 CATACAACAGAGAAGACAGAGGG + Intronic
1022388375 7:29922820-29922842 CTTAGCATTGGGAAGACAGAGGG - Intronic
1026246498 7:68624895-68624917 GATAACATGGAGGAGACACAGGG - Intergenic
1027854547 7:83492620-83492642 CATACTTTGGAGAAAGCAGAGGG + Intronic
1027867559 7:83666891-83666913 CATAGCATGGGGAAGTCACAGGG - Intergenic
1030745059 7:113155213-113155235 CATACCAGTGAGAAGACAGCAGG - Intergenic
1030854045 7:114528231-114528253 CATTTCGTGGAGATGACAGAAGG - Intronic
1030914485 7:115295732-115295754 CATAGCATGGGAGAGACAGACGG - Intergenic
1033591766 7:142814436-142814458 CAGAGCATGGCAAAGACAGAGGG - Intergenic
1035283473 7:157792194-157792216 CACACCTTGCAGAAGGCAGATGG - Intronic
1036577894 8:10045391-10045413 AATCCCAGGGAGAAGAAAGAAGG + Intergenic
1037175213 8:15939179-15939201 CATATGATGGAGAAGAGAGGAGG + Intergenic
1037358195 8:18045342-18045364 CATGCCATGGAGCAGAAAGAGGG - Intergenic
1037501914 8:19494795-19494817 CATAGCATTGAGAAACCAGATGG + Intronic
1037748434 8:21664246-21664268 CATACCAGGGAAGTGACAGAAGG + Intergenic
1037767277 8:21779979-21780001 GTTGCCATGAAGAAGACAGAAGG - Intronic
1038133659 8:24762225-24762247 CATAATAAGGAGAGGACAGAAGG - Intergenic
1038498001 8:28019593-28019615 ATTACCATGGAGAAGAGAGCAGG - Intergenic
1038708770 8:29921523-29921545 CATTGCCTGGAGATGACAGAAGG + Intergenic
1038865084 8:31430830-31430852 CACAAAATGGACAAGACAGATGG + Intergenic
1040687800 8:49896613-49896635 CATAACATGGAGAATAGAGATGG - Intergenic
1040986003 8:53294940-53294962 CATCCCCTGGAGAAGTCAGCAGG - Intergenic
1041848381 8:62358057-62358079 CATATCATGGAGATAACAGATGG + Intronic
1041960731 8:63612398-63612420 CTAACTATGGAAAAGACAGAAGG + Intergenic
1043350582 8:79355726-79355748 CAAACCATGGAAAATACACACGG + Intergenic
1043580071 8:81701961-81701983 TATTCCATAGAGAAGAAAGATGG - Exonic
1046215901 8:111146591-111146613 CATACCATCCAGAAGACTGGAGG - Intergenic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046650787 8:116834707-116834729 CATACCCTCCAGCAGACAGAGGG + Intronic
1047576991 8:126167148-126167170 CAAACCATATTGAAGACAGATGG - Intergenic
1048026934 8:130595971-130595993 CATGCCCTTGAGAAAACAGAAGG + Intergenic
1051464456 9:17361358-17361380 CATTCAATAGAGAACACAGATGG - Intronic
1051985566 9:23082432-23082454 CATTCCATAGAGAAGAAAAAGGG - Intergenic
1053786208 9:41654598-41654620 TAAACCATAGAGAAGACAGTGGG + Intergenic
1055583167 9:77729714-77729736 CATAACATGGAGAACTAAGAAGG - Intronic
1056150585 9:83783566-83783588 TATCAAATGGAGAAGACAGAAGG - Intronic
1056254370 9:84783656-84783678 AAGAGCATGGAGAAGAGAGAGGG + Intronic
1057266317 9:93620224-93620246 CAGACCTTTCAGAAGACAGAAGG - Intronic
1059125498 9:111680706-111680728 CATCCCATGGAAGAGACAGAAGG + Intergenic
1059306473 9:113357109-113357131 CCTCCTATTGAGAAGACAGAAGG + Intronic
1059846173 9:118279199-118279221 TATGCCATGGAGAATACACATGG + Intergenic
1060376746 9:123121459-123121481 CCTAACCTGGAAAAGACAGATGG + Intronic
1062219793 9:135409093-135409115 CATATGCTGGAGAAGGCAGAGGG - Intergenic
1185558759 X:1042537-1042559 TGGACCATGCAGAAGACAGAGGG + Intergenic
1186952851 X:14646711-14646733 CATACGATAGAGAAGACTTAGGG + Intronic
1188692943 X:33152919-33152941 AATCCCATTGAGAAGACAGAAGG + Intronic
1189533708 X:41913925-41913947 CATACCAAGGGTAAGAAAGAAGG + Intronic
1190006458 X:46744152-46744174 CATTCCAGGAAGCAGACAGAAGG + Intronic
1190061704 X:47215747-47215769 CCTACTTTGGAGAAGACAGCTGG + Intergenic
1192681642 X:73259243-73259265 CATACCATGAAGAATCCAGCAGG - Intergenic
1197465134 X:126795696-126795718 CATACCAAAGAGAAAACAGTAGG + Intergenic
1198149321 X:133892740-133892762 CATACCTTGGAGAGGACTAAAGG + Intronic
1198561292 X:137852727-137852749 CATACCAAGCAGCAGTCAGAAGG - Intergenic
1198963628 X:142205994-142206016 CATACCTTGAGAAAGACAGAGGG - Intergenic
1199274461 X:145925267-145925289 CATAACATGGATAAAACTGAGGG + Intergenic
1200066058 X:153504561-153504583 CCTGGCATGGAGAAGACAGGTGG + Intronic
1200248512 X:154539701-154539723 CATGTCATGAAGAACACAGATGG - Intronic
1200912875 Y:8546562-8546584 GATACCATAGAGAAGACAGGTGG - Intergenic
1200921003 Y:8612880-8612902 GATCCCACAGAGAAGACAGATGG - Intergenic