ID: 1003444149

View in Genome Browser
Species Human (GRCh38)
Location 6:6169545-6169567
Sequence CTAGTTTTCCAGGGATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003444149_1003444156 14 Left 1003444149 6:6169545-6169567 CCCATCAATCCCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 128
Right 1003444156 6:6169582-6169604 CTAGACTAGTAGTTGTCAATAGG No data
1003444149_1003444157 17 Left 1003444149 6:6169545-6169567 CCCATCAATCCCTGGAAAACTAG 0: 1
1: 0
2: 1
3: 16
4: 128
Right 1003444157 6:6169585-6169607 GACTAGTAGTTGTCAATAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003444149 Original CRISPR CTAGTTTTCCAGGGATTGAT GGG (reversed) Intronic
900575685 1:3381322-3381344 TTGTTTTTCCAGGGATTTATTGG + Intronic
903793832 1:25913421-25913443 CTGGTTTACCAGGGACTGAAGGG + Intergenic
903926774 1:26836005-26836027 CTGATTTTCCTGGGATTGAGTGG - Intronic
906463738 1:46057984-46058006 CTAGGCCTCCAGGGCTTGATGGG - Intronic
906533808 1:46540104-46540126 CCAGATTTCCAGGGACTGAGAGG - Intergenic
911123239 1:94316552-94316574 CTGGTTTTCTTGGGATTGAGGGG + Intergenic
913137509 1:115906843-115906865 CTGGTTTTCCAGGTATTGTGTGG + Intergenic
917072978 1:171173104-171173126 CTAGTTTTGCAGGCGTTAATTGG + Intergenic
917418592 1:174838005-174838027 CTAGTTTTCAAGGGGTTAAAGGG - Intronic
918926143 1:190789081-190789103 TTAGTTTTCCTGAGATTGAGGGG + Intergenic
920856011 1:209662461-209662483 CCAGTTTGCCTGGGACTGATGGG - Intergenic
920930502 1:210383449-210383471 ATTGTTTGCCAGGGATTGAGGGG + Intronic
921853932 1:219961388-219961410 CTTGTATTCTAGTGATTGATGGG + Intergenic
921860485 1:220037852-220037874 TTAGTTTTCCATGGAGTAATTGG - Intronic
923026068 1:230205099-230205121 CTGGAGTTTCAGGGATTGATGGG + Intronic
923256395 1:232225224-232225246 AGAGGTTTACAGGGATTGATTGG - Intergenic
1065465604 10:26017541-26017563 CCAGTTTTCTAGGGAGTGAAGGG + Intronic
1065828773 10:29595909-29595931 CTAGCTGTCCTGGGAATGATGGG - Intronic
1066262817 10:33745602-33745624 CCAGATTTCAAGGGATAGATGGG + Intergenic
1066579844 10:36868301-36868323 CTAGTTTTCCAGGAATAGAAGGG - Intergenic
1068486530 10:57666369-57666391 CAAGTTTTCCAGGAAGTTATGGG + Intergenic
1070727836 10:78804078-78804100 CTAGTTTGCCTGGGACTGAGGGG + Intergenic
1073680191 10:105694868-105694890 TTTGTTTTCCAGAGATTGAGTGG + Intergenic
1073721626 10:106179216-106179238 CTAGATTTCCAGGGATGGGTGGG + Intergenic
1073828144 10:107349630-107349652 TTAGTTTTCCAGGCATTCTTGGG - Intergenic
1075234840 10:120718211-120718233 CTAGTTTTCCAGGTTTAGTTGGG - Intergenic
1079351491 11:19695503-19695525 CTAGCTGTCCTGGGATTGATTGG + Intronic
1084608943 11:70188605-70188627 CTAGCTTTCCAGGGATAACTGGG - Exonic
1086075451 11:82846244-82846266 GTAGTGTTCCAGGGATTAGTGGG + Intronic
1086739694 11:90352203-90352225 TGAGTTTTCCATGGACTGATGGG - Intergenic
1087445686 11:98249804-98249826 CTAGTTTTGCAGGTATTCTTTGG + Intergenic
1087696364 11:101381136-101381158 TTATTTTTCCAGGTATTGAAAGG - Intergenic
1089169725 11:116503613-116503635 CTAGTTTGCCAGAGACTGAGGGG - Intergenic
1096658755 12:53108296-53108318 CCAGTTTTCAAGGGCTTTATTGG + Intronic
1098157296 12:67612811-67612833 CAATTTTTCCATGGATGGATGGG - Intergenic
1100424340 12:94469392-94469414 CAATTTTTCCACAGATTGATGGG + Intergenic
1102748713 12:115273157-115273179 CCCATTTTCCAGGGACTGATTGG - Intergenic
1103011232 12:117460120-117460142 CGAGTTTTCCATGGAATGAAAGG + Exonic
1109212161 13:59547497-59547519 CAGGTGTTCCAGGTATTGATGGG - Intergenic
1112247808 13:97750335-97750357 CTAGTTTCCCTGGGACTGAAGGG - Intergenic
1112431757 13:99356244-99356266 CTGGTGTTCCAGGGACTGATTGG - Intronic
1112597755 13:100824382-100824404 TCAGTTTTCCAGGGCTGGATTGG + Intergenic
1112982342 13:105400598-105400620 CTATTTTTCCAGTGAGTGAAGGG + Intergenic
1113224121 13:108140585-108140607 TTAGTTTTCCAGGGTTTGTCTGG - Intergenic
1114805571 14:25832421-25832443 CTAGATTTCCTGGGATTACTTGG - Intergenic
1115403495 14:32990595-32990617 CTAGTTTTCAAGTTTTTGATTGG - Intronic
1120749910 14:88187707-88187729 CTAGTTTTTCCAGGATTTATGGG + Intronic
1122442460 14:101741388-101741410 CTAGGTCTCCAGGCTTTGATGGG + Intergenic
1124694836 15:31855854-31855876 CTAATTTTACAGGGATTGAATGG + Intronic
1125740619 15:41961166-41961188 CTATTTTTCCAGCTATGGATGGG + Intronic
1133594128 16:7273803-7273825 TTATTTTTCCAGGGCTGGATTGG + Intronic
1137891674 16:52169632-52169654 CTAGCTTTCAATGGATTGAATGG - Intergenic
1144764876 17:17727152-17727174 CTAGTTTTCCTTGGATAAATGGG + Intronic
1145403171 17:22561435-22561457 CAAGATTTCCACTGATTGATGGG + Intergenic
1150333817 17:64315503-64315525 TTATTTTTCCAAGGATTTATTGG - Intergenic
1150696979 17:67413936-67413958 CAAGCGTTCCAGGGATTTATTGG + Intronic
1150961512 17:69917903-69917925 CTAGTTTTTAAAGGATTGAAGGG - Intergenic
1151071756 17:71221816-71221838 CTAGTTTGCCTAGGATTGAAAGG + Intergenic
1155603524 18:27576697-27576719 CTACTTTTCCAGAGATAGATTGG + Intergenic
1156254196 18:35379303-35379325 CTAGTTTTAAAGGGTTTGACAGG + Intergenic
1160189451 18:76703425-76703447 CTAGGTTTCCAGGCAATGAATGG - Intergenic
1164218182 19:23169579-23169601 CCAGTTTCCAAGGGATTTATTGG - Intergenic
925995939 2:9293220-9293242 ATCCTTTTGCAGGGATTGATGGG + Intronic
926647145 2:15302296-15302318 CTAGTTCTCCAGGGACTTCTTGG - Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928261088 2:29767447-29767469 CTGGTTTTCCAGGGACTGATGGG - Intronic
929333571 2:40712955-40712977 CTGGTGTTCCAGGGACTGCTGGG + Intergenic
931449433 2:62355993-62356015 CTGGTTTTCCATCGATTGAGGGG - Intergenic
932769225 2:74491327-74491349 CTGGGTTTCCAGGGCTGGATGGG - Exonic
933439195 2:82288804-82288826 CTAGGTTTCCAGGACTTGATTGG + Intergenic
934045934 2:88172434-88172456 TTAGTTTGCCTGGGATTGAGGGG + Exonic
936402765 2:112177819-112177841 AAAGTTTTTCAAGGATTGATGGG - Intronic
946632529 2:221685635-221685657 CTTGTTTTACAGTGTTTGATAGG - Intergenic
946740063 2:222792424-222792446 CCAGCTTTCCAGCTATTGATTGG - Intergenic
947045748 2:225981279-225981301 CTAGATTTCCAGGGATATATTGG - Intergenic
1168845870 20:944419-944441 CTAGATTTTCAGGGTTTGTTGGG + Intergenic
1168855705 20:1006144-1006166 CTGGTTTGCCAGGGATTGAGGGG + Intergenic
1172269652 20:33647226-33647248 CTAGTTTTTCATGGATTTGTTGG + Exonic
1174279008 20:49424903-49424925 TGGGTTTGCCAGGGATTGATGGG + Intronic
1174580005 20:51564558-51564580 CTGGTTTGCCTGGGATTGAGGGG + Intergenic
1174649183 20:52110310-52110332 ATGGTTTTCCAGGGTTTGGTAGG - Intronic
1177752767 21:25306326-25306348 CTAGTTTTTAAAGGATTCATTGG + Intergenic
1178101158 21:29270125-29270147 CCAGTTTTCCAGGAACTGAGAGG - Intronic
1178303231 21:31469916-31469938 CTAGATTTCCAGGCATGGGTAGG + Intronic
1179283239 21:39952958-39952980 CCGGTTTTCCAGGGACTGAGGGG - Intergenic
949574367 3:5324468-5324490 CTAGTTTTCTTGGGACTGAGGGG + Intergenic
950859750 3:16137586-16137608 CCAGTTTTCCTGGAATTGAGTGG + Intergenic
952756555 3:36873979-36874001 CAAGTTTTCCAAAGATTGGTAGG + Intronic
955022279 3:55132865-55132887 CAATTTTTCCAGGGATGGTTGGG - Intergenic
956604684 3:71062352-71062374 ATATTTTTCCAGGGATGGAATGG - Intronic
957483906 3:80832982-80833004 CTAGTTTTTCAGGTTTAGATGGG - Intergenic
957580315 3:82064226-82064248 CTAATATTCCTGGGTTTGATGGG + Intergenic
958682975 3:97354138-97354160 GTAGTTTTCCAGGTATTCAAAGG - Intronic
961189676 3:124948080-124948102 GTAGTTGTCAAGGGATTGAGGGG + Intronic
963274247 3:143314449-143314471 ATAGTTTTCTAGGGCTTGAAAGG + Intronic
963390845 3:144662064-144662086 CTAGTTTTCCAGTGTTTTAATGG + Intergenic
963613146 3:147497932-147497954 CTATTTATACATGGATTGATAGG + Intronic
970366686 4:15366290-15366312 CTAATTTTCCTGGGATTGAGGGG - Intronic
972225131 4:37003774-37003796 CAAGTTTGCCTGGGATTGAAGGG + Intergenic
972634674 4:40872601-40872623 CTAGCTTTCTGGGGATTTATTGG - Intronic
978159182 4:105526390-105526412 CTAGTTTTCCAGGGACTCTTGGG - Intergenic
978253732 4:106667240-106667262 GTATTTTGCCAGTGATTGATAGG + Intergenic
980255349 4:130372858-130372880 CTAATTTTCCCGGGCTTGATGGG + Intergenic
981202341 4:141995507-141995529 GAAGTTTTCCAGGGACTGAGTGG - Intergenic
982130623 4:152225565-152225587 ATAATTTACCAGCGATTGATGGG - Intergenic
985005691 4:185533174-185533196 CTTGCTTGCCAGGCATTGATGGG - Intronic
990350414 5:54910132-54910154 CCAGTTTTCCAGGGACTCAATGG - Intergenic
994275593 5:97832990-97833012 CTAGTTTTCAAGGGAAGGAATGG - Intergenic
994570153 5:101505351-101505373 CTAGATTTCCAAGGATATATGGG + Intergenic
996042423 5:118830559-118830581 CTATTTCTCCAGGGAGTGCTGGG + Intergenic
997669487 5:135658696-135658718 CTAGATTTCAAAGGATTTATGGG - Intergenic
999247818 5:150164683-150164705 CAAGTTTTCAAGGGATTGGTGGG - Intergenic
999390662 5:151187159-151187181 CTATTTTTCCAGGGACTGCTGGG - Intronic
1001236141 5:170031242-170031264 GTCCTTTTCCAGGGATTGAAAGG - Intronic
1003444149 6:6169545-6169567 CTAGTTTTCCAGGGATTGATGGG - Intronic
1004478656 6:15998406-15998428 CACTTTTGCCAGGGATTGATTGG + Intergenic
1006791788 6:36706251-36706273 CCAGTTTTCCAAGGACTAATGGG + Intronic
1007876709 6:45111432-45111454 CTAGTTTGCCTGGGATTGAGGGG + Intronic
1008368752 6:50710898-50710920 CTTCTTTTCCAGAGAGTGATTGG - Intergenic
1010645272 6:78380267-78380289 CTAGTATTTCAGGAAATGATAGG + Intergenic
1011055820 6:83202343-83202365 CCAGTTTTCCTGGGACTGAGGGG + Intergenic
1012172043 6:96029071-96029093 CTAGGTTTTCAGGAAATGATAGG + Intronic
1017574048 6:155781694-155781716 TTAGTTTCCCAGGTATTAATTGG - Intergenic
1020371363 7:7435492-7435514 CTAGTTTGCCCGGGATTGAAGGG - Intronic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1023763914 7:43493191-43493213 CTAGAGTTCCAGGGAGTGAGGGG - Intronic
1025733161 7:64124316-64124338 CCAGATTTCCAGGGATGGAGAGG + Intronic
1027501263 7:78954399-78954421 CTATTTTTCCAGTGATTCTTTGG - Intronic
1027558433 7:79695668-79695690 CTGGTTTGCCAGGGTTTGCTAGG + Intergenic
1031238685 7:119210946-119210968 CTAGATTTCAAAGGATGGATGGG + Intergenic
1031606656 7:123776228-123776250 CGTGATTTCCATGGATTGATTGG + Intergenic
1037109937 8:15153902-15153924 CAAGTTTTCCAGGGATGTAGGGG + Intronic
1038452825 8:27650838-27650860 CTGGTTTGCCAGGGACTGAGGGG + Intronic
1039770357 8:40680295-40680317 CTAGCTTTCCTGGGACTGAGAGG + Intronic
1040551115 8:48438448-48438470 CTTGTTTTGCAAAGATTGATTGG + Intergenic
1042175661 8:66035190-66035212 CTAGATTTCCAGGGATGGTGGGG - Intronic
1048643898 8:136396099-136396121 TGTGTTTTCCTGGGATTGATGGG + Intergenic
1051774379 9:20619686-20619708 TTAGTTTTCCAGAGGTTGAAGGG + Intronic
1055730169 9:79272781-79272803 CTAGTTTTCCAAGGACTGGGGGG + Intergenic
1055769665 9:79703724-79703746 CTAGGTTTCCAGACATTGAAAGG + Intronic
1056528694 9:87467994-87468016 TGAGTTTTCCAGGGAAGGATTGG - Intergenic
1058810883 9:108637771-108637793 CTGGTTTGCCAGGGACTGAATGG + Intergenic
1188190510 X:27166529-27166551 CTTGTTATCCAGAGTTTGATAGG - Intergenic
1189592097 X:42524360-42524382 CTAGTTTTCCAGAGAGAAATAGG - Intergenic
1194556635 X:95368239-95368261 CTGGTTTTTCAGGCAATGATTGG - Intergenic
1201042749 Y:9853615-9853637 CAATTTTTCCATGGATTTATTGG - Intergenic