ID: 1003445098

View in Genome Browser
Species Human (GRCh38)
Location 6:6176970-6176992
Sequence AAGCAGGCTGGGGCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003445091_1003445098 4 Left 1003445091 6:6176943-6176965 CCTCTGTGAGCGGAGACCGCCAA 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1003445098 6:6176970-6176992 AAGCAGGCTGGGGCTGTTCCAGG No data
1003445089_1003445098 23 Left 1003445089 6:6176924-6176946 CCTTCTGGGGAAGCACTGTCCTC 0: 1
1: 0
2: 0
3: 22
4: 273
Right 1003445098 6:6176970-6176992 AAGCAGGCTGGGGCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003445098 Original CRISPR AAGCAGGCTGGGGCTGTTCC AGG Intronic