ID: 1003448171

View in Genome Browser
Species Human (GRCh38)
Location 6:6204492-6204514
Sequence ATGTATTAGCAGAACCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003448171_1003448174 26 Left 1003448171 6:6204492-6204514 CCTCTCTGGTTCTGCTAATACAT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1003448174 6:6204541-6204563 ACAATAATGACAGGACATCCTGG 0: 1
1: 0
2: 1
3: 9
4: 134
1003448171_1003448173 17 Left 1003448171 6:6204492-6204514 CCTCTCTGGTTCTGCTAATACAT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1003448173 6:6204532-6204554 ATATTGTTGACAATAATGACAGG 0: 1
1: 0
2: 1
3: 12
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003448171 Original CRISPR ATGTATTAGCAGAACCAGAG AGG (reversed) Intronic
903186002 1:21629427-21629449 ATGTGGGTGCAGAACCAGAGCGG + Intronic
904058997 1:27692512-27692534 ATGTCTTATCAGAATCAGAGGGG + Intergenic
905722258 1:40215146-40215168 ATGAAATAGCAGAATCAAAGAGG + Intronic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
906188582 1:43880766-43880788 ATGTATTACCAGAAGCAATGCGG + Intronic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
912753313 1:112303460-112303482 AAGTATTAGAAAAATCAGAGTGG + Intergenic
918266910 1:182851241-182851263 ATATATTGGCAGAAGCAAAGTGG + Intronic
918382548 1:183970860-183970882 AAGTATTAGGAAAACCATAGAGG - Intronic
1062847113 10:716254-716276 ATGGATTAGCAGCACCACACAGG - Intergenic
1063262800 10:4409389-4409411 ATGTGTTTGCAGAACCTGAGGGG - Intergenic
1063411710 10:5841174-5841196 GTTTATTTGCAGCACCAGAGAGG - Intronic
1065841266 10:29703449-29703471 ATGAATGAGCAGAACATGAGTGG - Intronic
1071836508 10:89423655-89423677 ATGTACAAGCAGAAAGAGAGGGG - Intergenic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1086801172 11:91177511-91177533 ATTTTTTAACAGAACCAGATAGG + Intergenic
1095253545 12:40006250-40006272 ATGTATAAGCTGTAACAGAGTGG + Intronic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096356684 12:50947239-50947261 ATGTATTACCATAACCTAAGTGG + Intergenic
1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG + Intergenic
1099475659 12:83104744-83104766 AGGTATTTGCAGAACCAAAATGG - Intronic
1099698886 12:86059682-86059704 ATCTTTTAGCACAACCACAGTGG + Intronic
1102363398 12:112309371-112309393 ATGCATTAACAGAACAAGATGGG + Intronic
1104266880 12:127241900-127241922 ATGTATTATCTCATCCAGAGGGG - Intergenic
1105595844 13:21837219-21837241 ATGATTTTGGAGAACCAGAGAGG - Intergenic
1106438458 13:29744194-29744216 ATGTATTCCTGGAACCAGAGAGG + Intergenic
1106522580 13:30511002-30511024 ATGTACTAAGTGAACCAGAGTGG + Intronic
1109901705 13:68781175-68781197 ATGTATTTGCGGAAGCAGAGTGG - Intergenic
1111425363 13:88073130-88073152 ATGAAGTAGGAGAACCAGAGTGG - Intergenic
1113204768 13:107903866-107903888 ATGTATTAACACAAACTGAGTGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1117247121 14:53897329-53897351 ATGTATTGGAACAACCAGTGGGG - Intergenic
1119023888 14:71137439-71137461 ATGTACTGGCAGAAGCAGAGAGG - Intergenic
1125098733 15:35885347-35885369 ATGTAACAGCATAAACAGAGGGG - Intergenic
1130035033 15:80351539-80351561 ATGTCTTGTTAGAACCAGAGAGG - Intronic
1131755553 15:95557207-95557229 ATAGAATAGTAGAACCAGAGAGG + Intergenic
1135037714 16:19091901-19091923 ATGTATTAGCAGCATGAGAACGG + Intergenic
1135183455 16:20294643-20294665 CTGTATTAGCATCACCTGAGGGG - Intergenic
1137984099 16:53093197-53093219 ATGAATTTGCAGATTCAGAGAGG - Intronic
1140951249 16:79819858-79819880 ATGTCTTAAGAGAAGCAGAGTGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141171376 16:81693797-81693819 ACATAATAGCAGAACCAGACAGG - Intronic
1142628153 17:1205311-1205333 ATTTATTCTCACAACCAGAGAGG - Intronic
1145936119 17:28715887-28715909 GTGTCTTTGCAGAACCTGAGAGG + Exonic
1147625086 17:41895026-41895048 ATGTCTCAGCAGAACCCGGGGGG - Intronic
1151390470 17:73783775-73783797 CTGAATTAGGAGACCCAGAGGGG + Intergenic
1151752017 17:76044655-76044677 GTTAATTAGCAGAACCAGTGTGG - Intronic
1153033992 18:741479-741501 GTATATTAGATGAACCAGAGGGG - Intronic
1153537858 18:6121951-6121973 ATGTATATGCAGAACTGGAGTGG - Intronic
1155441150 18:25864098-25864120 ATGTATTAGGAAAACAGGAGAGG + Intergenic
1157874481 18:51259773-51259795 ATGTATTTGGAGAACTTGAGTGG - Intergenic
1158254087 18:55526143-55526165 ATGTATTTACAGAACCACAAAGG + Intronic
1165822817 19:38687271-38687293 AGGTCTCAGTAGAACCAGAGGGG - Intronic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
927773877 2:25887043-25887065 ATGTAATACCAGAAGAAGAGGGG + Intergenic
929421148 2:41790928-41790950 ATCCATTAGGAGAACCAGAGAGG - Intergenic
930560388 2:52953036-52953058 AGGCACTAGCAGAACCACAGAGG - Intergenic
931798969 2:65740305-65740327 AGGTATTAAAAGAAACAGAGAGG - Intergenic
932846929 2:75145021-75145043 ATGTATTAACACAGCCTGAGCGG + Intronic
935220504 2:101008294-101008316 AGGTAGCAGCAGAACCAGGGTGG + Intronic
936466541 2:112756780-112756802 ATATCTTAACAGAACCTGAGAGG - Exonic
937661245 2:124432112-124432134 ATGTGATAGCAAAAACAGAGGGG + Intronic
939750392 2:146037796-146037818 CTGTATTAGCTGAACAATAGGGG - Intergenic
940558736 2:155266407-155266429 ATGTAACAGCAGATCCTGAGGGG + Intergenic
942233383 2:173880515-173880537 ATGAATCATCAGAACCAGACTGG + Intergenic
942834668 2:180279343-180279365 ATGTAAGAGCAGATACAGAGAGG - Intergenic
945976486 2:216275133-216275155 ATTTATTGGGAGAAGCAGAGTGG - Intronic
946548896 2:220778354-220778376 ATGAGTTAGCAGATCCACAGCGG - Intergenic
1169719055 20:8652679-8652701 ATATATTACCAGAAACACAGTGG + Intronic
1177412733 21:20751114-20751136 ATGGAATACCAGAACCAGCGTGG + Intergenic
1181905643 22:26193447-26193469 ATGTGATAGCAGAACCACATTGG - Intronic
950969923 3:17176112-17176134 AGGTAATAGCAGAACCAGGCAGG - Intronic
951064289 3:18246413-18246435 CTGTGTAAGCAGAACAAGAGAGG - Intronic
951669256 3:25162007-25162029 ATGTATCAGCAGAACCTGTGTGG + Intergenic
957567328 3:81901803-81901825 ATCTATTAGAGGAAACAGAGTGG - Intergenic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
961834447 3:129645252-129645274 AGGTATTAGCAAAACCACAGAGG - Intergenic
963094394 3:141520334-141520356 AGGGATTGGCAGAAGCAGAGGGG + Intronic
968850517 4:3074709-3074731 AGGTAAAAGCAGAACCTGAGCGG - Exonic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
969841127 4:9882868-9882890 ATTTATTAGCAGAACAATAAGGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
977087775 4:92626200-92626222 ATCTATAATCAGAACCTGAGTGG + Intronic
979227817 4:118309732-118309754 ACTTATTAGCAGAACTAGGGAGG + Intronic
981716318 4:147756194-147756216 AGGTATTAGCAGAAGCTGACTGG - Intronic
986793711 5:11189070-11189092 ATCTATTAACAGAACCATTGTGG - Intronic
990241611 5:53821880-53821902 ATATATTAGCAAAACCAAACAGG - Intergenic
993251442 5:85529679-85529701 ATGTATTTTCAAAAGCAGAGAGG - Intergenic
993418517 5:87668701-87668723 GTATATTATCAGAAACAGAGAGG + Intergenic
996354586 5:122581676-122581698 ATGTTTTAGCCAAGCCAGAGAGG + Intergenic
997098765 5:130944352-130944374 TTGTATTAGCATAACAAGAAAGG - Intergenic
999039057 5:148386366-148386388 ATGAACAAACAGAACCAGAGAGG - Intronic
1000395802 5:160773552-160773574 GTATATTAGCAGCTCCAGAGCGG + Intronic
1003448171 6:6204492-6204514 ATGTATTAGCAGAACCAGAGAGG - Intronic
1004018742 6:11757039-11757061 TTGTATTAACAGAACCAAAATGG + Intronic
1004035888 6:11922935-11922957 ATGTATTAGTGGATCCACAGTGG + Intergenic
1005143130 6:22657135-22657157 AGGTATTATTAGAAACAGAGAGG - Intergenic
1007194929 6:40052198-40052220 AGTTACTAGCACAACCAGAGAGG + Intergenic
1009382575 6:63050847-63050869 ATGTGGTAGCAGAACCACAAAGG + Intergenic
1010672576 6:78703714-78703736 ATGCGTTATCACAACCAGAGAGG - Intergenic
1011957648 6:93043088-93043110 CTGAATTAGGAGAACCAGTGGGG - Intergenic
1012110653 6:95227346-95227368 ATGTATTAGCAGCGCTAGAAGGG - Intergenic
1014685807 6:124498836-124498858 ATGTTTTAGCAGAACTTTAGTGG - Intronic
1015512757 6:134055234-134055256 AGGAATTGGCAGAAACAGAGAGG - Intergenic
1021259167 7:18432317-18432339 ATCTATTAGAAGAAACAGACAGG - Intronic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1023792974 7:43768580-43768602 ATGAACTAGCTGACCCAGAGAGG + Intronic
1030711968 7:112759824-112759846 ATGTTTTGGCAAAACTAGAGTGG + Intergenic
1030763083 7:113375311-113375333 ATGTATTTGCAAAGCCAGATGGG + Intergenic
1031014554 7:116558959-116558981 ATGTGATTGCAGAACCAGAAGGG + Exonic
1032536736 7:132670811-132670833 AGGTATTAGACGAGCCAGAGTGG + Intronic
1038841281 8:31186888-31186910 AGGTATTGACTGAACCAGAGTGG + Intergenic
1039471876 8:37818539-37818561 ATGTAGGAGCAGTACTAGAGTGG + Intronic
1041527348 8:58822301-58822323 AGGTAGTAGCAGAAAAAGAGAGG - Intronic
1042799537 8:72703614-72703636 ATGTACTTTCAGAATCAGAGAGG + Intronic
1043760569 8:84062937-84062959 ACGTATTAGCTCAACCACAGTGG - Intergenic
1044387602 8:91607929-91607951 ATGTCTCAGCAGAACCAGGCAGG - Intergenic
1050099742 9:2106237-2106259 GAGTTTTAGCAGATCCAGAGAGG + Intronic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1052164264 9:25304293-25304315 ATGTGTTAGCACTACCAGATGGG + Intergenic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1055858607 9:80722616-80722638 ATGTATTAGCAGCATGAGAATGG - Intergenic
1057706393 9:97398111-97398133 AGGTATTGGCAGAACCAGTTTGG - Intergenic
1059640281 9:116210020-116210042 GTGTAATAGCAGAAAAAGAGGGG - Intronic
1060906891 9:127314693-127314715 ATGTATGAGGAGAGACAGAGTGG + Intronic
1186616179 X:11190628-11190650 ATGAAATAACAGAAACAGAGGGG + Intronic
1187570883 X:20500136-20500158 ATGTTTTTGCTGAAACAGAGAGG + Intergenic
1189803674 X:44714851-44714873 AAGAAATAGCAGAGCCAGAGTGG - Intergenic
1191055446 X:56235073-56235095 ATGTATTAGAACAATGAGAGTGG - Intronic
1193025262 X:76839896-76839918 TTTTATTAGCAGAATCAGAATGG - Intergenic
1193234062 X:79085158-79085180 ATGTAATAGTAAATCCAGAGGGG - Intergenic
1194215394 X:91124448-91124470 TTGTATGAGCAGGACCGGAGAGG + Intergenic
1198209330 X:134502027-134502049 ATGTCTTATCAGAACCAGGGAGG + Intronic
1198694872 X:139325102-139325124 AGGTACTAGCACAACCACAGGGG + Intergenic