ID: 1003450430

View in Genome Browser
Species Human (GRCh38)
Location 6:6226263-6226285
Sequence CATGAATGCCTCAAGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003450430_1003450433 2 Left 1003450430 6:6226263-6226285 CCTTGCTACTTGAGGCATTCATG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1003450433 6:6226288-6226310 TCAGCAATATTGGCATTCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 341
1003450430_1003450434 3 Left 1003450430 6:6226263-6226285 CCTTGCTACTTGAGGCATTCATG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1003450434 6:6226289-6226311 CAGCAATATTGGCATTCCCTGGG No data
1003450430_1003450432 -8 Left 1003450430 6:6226263-6226285 CCTTGCTACTTGAGGCATTCATG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1003450432 6:6226278-6226300 CATTCATGGATCAGCAATATTGG 0: 1
1: 0
2: 0
3: 6
4: 113
1003450430_1003450435 14 Left 1003450430 6:6226263-6226285 CCTTGCTACTTGAGGCATTCATG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1003450435 6:6226300-6226322 GCATTCCCTGGGAGCTTGTTAGG 0: 1
1: 3
2: 25
3: 69
4: 235
1003450430_1003450438 30 Left 1003450430 6:6226263-6226285 CCTTGCTACTTGAGGCATTCATG 0: 1
1: 0
2: 0
3: 10
4: 100
Right 1003450438 6:6226316-6226338 TGTTAGGAATTCAGAATCTGAGG 0: 1
1: 2
2: 33
3: 268
4: 1085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003450430 Original CRISPR CATGAATGCCTCAAGTAGCA AGG (reversed) Intronic
901732770 1:11292380-11292402 CTTGAATGCCTCTAGTCACAAGG - Intronic
902752440 1:18526550-18526572 CATGAAGGCCACAGGTAGCATGG - Intergenic
905520224 1:38593288-38593310 CATGACACCCTCAAGCAGCAGGG + Intergenic
906937908 1:50230421-50230443 CATGAATGCATAAAATAGCCTGG - Intergenic
907316213 1:53574414-53574436 CATTACTGCCACAAGCAGCAGGG + Intronic
908885960 1:68788345-68788367 AATGAATACTTAAAGTAGCAAGG + Intergenic
912010232 1:104950604-104950626 CATGATTGCTTCAAGTAGAAAGG + Intergenic
912549797 1:110477875-110477897 CAGGCAGGCCTCAAGTGGCAGGG - Intergenic
917089512 1:171338498-171338520 CTGGAATGCCTAAAGCAGCATGG - Intronic
923047263 1:230364494-230364516 CATAAATGTATCAAGCAGCAGGG + Intronic
1064319266 10:14287139-14287161 CATGAATGCATCACGGAGCGGGG - Intronic
1068732020 10:60368913-60368935 GCTGACTGCTTCAAGTAGCAGGG + Intronic
1074065777 10:110012108-110012130 AGAGAATCCCTCAAGTAGCATGG - Intronic
1075881609 10:125857071-125857093 CAAGAAAGCATCAAATAGCATGG + Intronic
1077915637 11:6609947-6609969 CATGACTGCCCGAATTAGCATGG + Exonic
1078911272 11:15734680-15734702 CACCAATGCCCCAAGTAGAAGGG + Intergenic
1079067272 11:17306466-17306488 CCTGACTACCCCAAGTAGCATGG - Intronic
1080575415 11:33594476-33594498 CAGGAATACCCCAGGTAGCAAGG + Intronic
1081624259 11:44638346-44638368 CCTCAGTGTCTCAAGTAGCAGGG - Intergenic
1085028368 11:73253884-73253906 CATTAATGCCAAAAGCAGCATGG + Intergenic
1089880803 11:121771738-121771760 CATCTAGGCCTGAAGTAGCAAGG + Intergenic
1090732532 11:129584101-129584123 CATGAATACCTCTAGTGTCAGGG - Intergenic
1096162983 12:49395939-49395961 CACAGATGCATCAAGTAGCATGG - Intronic
1096531060 12:52243161-52243183 CCTGCATGCCCCAAGTAGCAGGG - Intronic
1097020126 12:56014832-56014854 CATGAAGGCCTTGAGTAGCCTGG + Intronic
1097941340 12:65309800-65309822 CATGAAGGCCTGAAAGAGCAAGG + Intronic
1107338016 13:39376230-39376252 CAAGAATGCCTCAAACACCAGGG + Intronic
1108374662 13:49802899-49802921 CATAAATTCCTCAAATAGTAGGG - Intergenic
1110100308 13:71592377-71592399 CCTCAATACCTCAAGTAGCTGGG - Intronic
1112146317 13:96704434-96704456 TGTGGATGCCTCAAGTAGGAAGG + Intronic
1115054023 14:29100223-29100245 CCTGAATGCCTAATGTAGCAAGG + Intergenic
1115980539 14:39047008-39047030 CAAGAATGACTGAAGTAGTAAGG - Intronic
1117481455 14:56149460-56149482 AATGCCTGCCTCAAGGAGCATGG + Intronic
1118501706 14:66368313-66368335 CAAGAATGCCAGAAGCAGCAGGG + Intergenic
1121529469 14:94642066-94642088 CTTGAATGCCTCCCGTAACAGGG + Intergenic
1124865653 15:33488099-33488121 CATTAATAACTCAAGTAGGAAGG - Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1126066486 15:44829978-44830000 CATGCCTGCCTCAGGTAGCCTGG + Intergenic
1126093395 15:45070891-45070913 CATGCCTGCCTCAGGTAGCCTGG - Intronic
1126783975 15:52161735-52161757 CCTGAATGACTCAACAAGCAAGG + Intronic
1130701550 15:86187891-86187913 CCTGAATGCCTGAGGTTGCAGGG - Intronic
1142413963 16:89931329-89931351 TATGAAGGCCTCAAGAAACAAGG - Intronic
1149662441 17:58341818-58341840 CCTCAGTGCCTCAAGTAGCGGGG - Intergenic
1151268740 17:72977173-72977195 CATGACTGGCTGAAGAAGCAGGG + Intronic
1153547950 18:6228772-6228794 CCTGAGTGCCTCCAGGAGCAGGG + Intronic
927033546 2:19148199-19148221 AATGAATGCCTGAGGTAGCATGG - Intergenic
927685046 2:25164707-25164729 CATGGAGGCCTGAAGCAGCAAGG + Exonic
928123528 2:28600955-28600977 CTTGAATGCCTCTAATAACATGG - Intronic
931107854 2:59076940-59076962 CTTCATTGCCTCAATTAGCATGG - Intergenic
934127684 2:88914336-88914358 CCTCAATGTCTCAAGTAGCTGGG - Intergenic
936833591 2:116679718-116679740 CATGAAAGCCTCAAGTCTTAAGG + Intergenic
940356773 2:152752390-152752412 CATGCGTGCCTCTAGTACCAGGG + Intronic
941068090 2:160925870-160925892 TGTAAATGCCTCAAGTAACAGGG + Intergenic
942668340 2:178346824-178346846 CATGAATTCCTCAATTAAAATGG + Intronic
947092036 2:226522579-226522601 CATGAATGCATTAAGAAGAATGG - Intergenic
1174097463 20:48100656-48100678 CATGACTGCCCCCAGCAGCAAGG - Intergenic
1178302891 21:31467705-31467727 CATCAGTGTCTCAAGTAGCTGGG - Intronic
1182550148 22:31096599-31096621 CATGAATGACACAGGTAACAAGG - Intronic
1185027418 22:48423550-48423572 CATGAAGGCTGCAAGCAGCACGG - Intergenic
951634682 3:24760237-24760259 CATGAATGCATCAATAATCAAGG + Intergenic
954010180 3:47629569-47629591 GAAGAATGTCACAAGTAGCAAGG - Intronic
961540218 3:127594348-127594370 CATGTATGCCTCTAGTATCATGG - Intronic
964414609 3:156434053-156434075 CTTGGAAGCCTCAATTAGCATGG + Intronic
966554932 3:181248087-181248109 AATGAATGTCACAAGTAGAATGG - Intergenic
966894169 3:184430001-184430023 CAGGAATGTCTCAAGGAGCCTGG + Intronic
967929047 3:194677295-194677317 CTTGAATGCCTCTGGTGGCAGGG - Intergenic
968563674 4:1298078-1298100 CTAAAATGCCTCAAGAAGCATGG - Intronic
970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG + Intergenic
974440027 4:61903886-61903908 CCTCAACCCCTCAAGTAGCAGGG + Intronic
976129372 4:81868423-81868445 ACTGATTGCCTCAGGTAGCACGG + Intronic
976638617 4:87313127-87313149 CATGAAGGACTCCAGTGGCAGGG + Intronic
976774369 4:88691268-88691290 CATCAGTGCCTAAAGTAGCATGG - Intronic
981253060 4:142626946-142626968 AATGAAAGCCTCAAGTAGCTAGG + Intronic
981445623 4:144834553-144834575 CATCAATCTCCCAAGTAGCAGGG + Intergenic
983264657 4:165495240-165495262 GATGAATTCCCCAAGCAGCAGGG - Intronic
983527542 4:168774610-168774632 CCTTAGTGCCTCAAGTAGCTGGG - Intronic
984371993 4:178879987-178880009 CATGTATGCCTTAAATAGAAAGG - Intergenic
992225251 5:74614132-74614154 AATAAATGCCTCATCTAGCATGG - Intergenic
992777269 5:80099280-80099302 CATGAACACCTCAAGTGACAGGG + Intergenic
995913772 5:117218695-117218717 TTTGAATGCCTTAAGTAACAGGG - Intergenic
997118299 5:131149239-131149261 AATGAATCCCTCAAATAGGAAGG + Intergenic
997335393 5:133105117-133105139 CATGAATACCCCAAGCATCAAGG + Exonic
999293618 5:150444084-150444106 ACTTAATGCCGCAAGTAGCATGG + Exonic
1000516600 5:162242997-162243019 GATGAATGTCTCAAGCAGCTTGG + Intergenic
1000635145 5:163635450-163635472 CATAAATGGCCTAAGTAGCAAGG - Intergenic
1003450430 6:6226263-6226285 CATGAATGCCTCAAGTAGCAAGG - Intronic
1003795544 6:9598671-9598693 AATGAATGCATCAACTAGGAAGG - Intronic
1014370023 6:120594381-120594403 CATGAATGCACCAAATTGCAGGG + Intergenic
1015879732 6:137859487-137859509 CATGAAAGCCTCAAGAATCAAGG + Intergenic
1017625909 6:156348564-156348586 CATGACTGCTACAAGGAGCAAGG + Intergenic
1019065814 6:169296691-169296713 CAAGAATGCCTCAAGGCACAGGG - Intergenic
1020174285 7:5869833-5869855 TATGAATGCTTCAAGAAGGAAGG - Intergenic
1026646537 7:72175645-72175667 CATGAATACCTCCAGTACCAAGG - Intronic
1027650027 7:80854971-80854993 CATGCATGCTTTAAATAGCATGG - Intronic
1028158351 7:87457474-87457496 CCTGAATGCCTCCCGTAGTAAGG + Intronic
1030667622 7:112297857-112297879 CAAGAATGGCTGAAGTAGTAGGG - Intronic
1043715110 8:83473546-83473568 GATGAATGTCTCAAATAACAAGG + Intergenic
1043967193 8:86492535-86492557 CATCAGTGTCTCAAGTAGCTGGG - Intronic
1044369219 8:91389425-91389447 CATAAATACCTCAACAAGCATGG - Exonic
1046611043 8:116426067-116426089 CAGGAATTACTCAAGGAGCAGGG + Intergenic
1048759027 8:137771025-137771047 CATGAATTCCACAGGTAGCCTGG - Intergenic
1055250403 9:74296647-74296669 CTTTTAAGCCTCAAGTAGCAAGG + Intergenic
1056571161 9:87816518-87816540 CTTGAATCCCTCAAGTAGGTGGG - Intergenic
1186479670 X:9886630-9886652 CATGAATGCAGAAAGTAGAATGG - Intronic
1186589305 X:10913012-10913034 AAAGAATGCCCCAAGTACCAAGG - Intergenic
1187466815 X:19534790-19534812 AATAACAGCCTCAAGTAGCAAGG + Exonic
1189085256 X:38016383-38016405 CATGTCTGCCACATGTAGCAAGG - Intronic
1197178569 X:123510364-123510386 GATGTATGGCCCAAGTAGCAAGG - Intergenic
1198156267 X:133963898-133963920 CCTGAATGCCTCAAGAGACAGGG - Intronic
1198420348 X:136465372-136465394 CATGAAAGCCTCAAGTCCCGAGG + Intergenic
1201063833 Y:10070432-10070454 CATGAATGCCTCAGGCCACAGGG + Intergenic