ID: 1003456393

View in Genome Browser
Species Human (GRCh38)
Location 6:6286545-6286567
Sequence TTCTTGCCTCCTCATAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003456393_1003456396 2 Left 1003456393 6:6286545-6286567 CCTGCCTTATGAGGAGGCAAGAA 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003456396 6:6286570-6286592 GAGGCTGCTGTAGATCCATGTGG 0: 1
1: 1
2: 4
3: 60
4: 244
1003456393_1003456398 27 Left 1003456393 6:6286545-6286567 CCTGCCTTATGAGGAGGCAAGAA 0: 1
1: 0
2: 0
3: 19
4: 149
Right 1003456398 6:6286595-6286617 TCACTGCTGCTAACATACTTTGG 0: 3
1: 13
2: 19
3: 40
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003456393 Original CRISPR TTCTTGCCTCCTCATAAGGC AGG (reversed) Intronic
900077947 1:833342-833364 TTCTTGCCTCCTCAGTGTGCTGG + Intergenic
905286841 1:36886195-36886217 TCCTTCCCTCCACATGAGGCCGG - Intronic
906461206 1:46035978-46036000 TTCTTGGCCCCTCCTGAGGCTGG - Exonic
912233676 1:107824516-107824538 TGCTTACTTCCTCAGAAGGCTGG - Intronic
915073138 1:153288730-153288752 GCCCTGCCTCCTCATTAGGCAGG + Intergenic
915353597 1:155241908-155241930 TTCTTCCTTCCTCACAAGACAGG + Intronic
917302779 1:173594710-173594732 TACTTTCCTCCAAATAAGGCAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918257966 1:182767155-182767177 TTCCTGCCAGCTCAAAAGGCTGG + Intergenic
921340916 1:214133449-214133471 ACCGTGCCTCCTCATATGGCAGG + Intergenic
1063364504 10:5481537-5481559 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1066112156 10:32207068-32207090 TTCTTGTATCCTCACATGGCGGG - Intergenic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1067832130 10:49616393-49616415 CTCTGGCCTCCTCATGGGGCTGG + Intronic
1069727855 10:70592808-70592830 TTCTGGCCTCCTGATGGGGCAGG + Intergenic
1070600592 10:77863907-77863929 TTCCAGCTTCCTCGTAAGGCAGG - Intronic
1073909630 10:108326288-108326310 TTTTTGCCTCCTCAGAAGAAAGG - Intergenic
1073930288 10:108567016-108567038 TTTTAGCCTCCTCATTCGGCGGG - Intergenic
1074927831 10:118091815-118091837 TTCCTGCCTCCTTTTTAGGCAGG - Intergenic
1077453440 11:2664348-2664370 TTCCTGCATCCTCAGAAGTCAGG + Intronic
1079329583 11:19522500-19522522 TTCTTCCCTCCTCACCAGCCGGG + Intronic
1080040321 11:27753385-27753407 TTCTGGCCTCCTCACAACTCAGG - Intergenic
1082623512 11:55454546-55454568 TTCATGCCTCTTCACAGGGCAGG - Intergenic
1083224547 11:61276676-61276698 CTCTTGCCTCCTCCTCAGGCTGG - Exonic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1089104808 11:115993676-115993698 TACTTGCCTCCTCCTCAGGATGG - Intergenic
1092470714 12:8777586-8777608 TTTTTGGCTCCTGAAAAGGCTGG - Intronic
1099790977 12:87333009-87333031 TTCTTCACTTCTCAGAAGGCAGG + Intergenic
1100207513 12:92367000-92367022 TTTCTGCTTCCTCATACGGCAGG - Intergenic
1102150658 12:110687605-110687627 CTCTTGCCGCCTCATCACGCTGG - Intronic
1103235968 12:119372679-119372701 GTCATGCCTGCTGATAAGGCGGG - Intronic
1104290041 12:127458092-127458114 TTTTTTACTCCTCATAAGGCAGG + Intergenic
1107590874 13:41903573-41903595 TTCTTGCCTCCTTGTAATTCAGG - Intronic
1109007267 13:56893945-56893967 TTCTTGCCTTCTCAGAAGAAAGG + Intergenic
1112120064 13:96400346-96400368 TTCTTGACTCCTGAATAGGCTGG + Intronic
1112254175 13:97814063-97814085 TTCATTCTTCCTCATATGGCTGG - Intergenic
1114416264 14:22546529-22546551 CTGTTTCCTCCTCAAAAGGCAGG + Intergenic
1116775517 14:49176450-49176472 TTCTTGCCTCCTACTAATGTTGG - Intergenic
1117013262 14:51492117-51492139 TTCCTGACTCCTCTTAAAGCAGG - Intronic
1117503096 14:56374034-56374056 TCCATTCCTCCTCACAAGGCAGG - Intergenic
1118102455 14:62622299-62622321 TTCTTACCTGCTCACCAGGCAGG - Intergenic
1119881867 14:78106069-78106091 TTCTAGGCTGCTCACAAGGCTGG + Intergenic
1120637894 14:86974238-86974260 TTCACTCCTCCTCATAGGGCAGG + Intergenic
1121400259 14:93669919-93669941 GTCTTGCCCCCTCATATGTCTGG - Intronic
1127254993 15:57282469-57282491 TTCTTCCCTTCTCTTAAGGCAGG - Exonic
1129444839 15:75609703-75609725 CTCTTGCCTCCTCATTCTGCAGG + Intronic
1131025339 15:89136795-89136817 ATCTTCCCTCCCCATAACGCTGG + Intronic
1137061727 16:35796533-35796555 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1137739391 16:50752733-50752755 TTCTAGGCTCCTCATAAGAGTGG + Intronic
1138066680 16:53948591-53948613 ATCCTGCCTCCTCGCAAGGCTGG - Intronic
1138236482 16:55387610-55387632 TTCTTGTATCCTCATATGGCAGG - Intergenic
1138747231 16:59377346-59377368 TTCTTGTATCCTCACATGGCAGG + Intergenic
1139226105 16:65234498-65234520 TTCTTGCCTCCTAGGAAAGCGGG + Intergenic
1141007893 16:80370285-80370307 TTCTTGCCACAGCTTAAGGCTGG - Intergenic
1143973372 17:10812250-10812272 TTCTGCCCCCCTCATGAGGCTGG + Intergenic
1146265262 17:31448673-31448695 ATTTTGCCTCCTCTCAAGGCTGG + Intronic
1150419338 17:65017416-65017438 CATTTGCCTCCTCATAAGGCAGG - Intronic
1151884025 17:76912802-76912824 TTCTTCCCTCCGCACACGGCGGG - Intronic
1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG + Intronic
1163697010 19:18769097-18769119 TTCTTGCCTCCTAGGAAGCCTGG - Intronic
1164467989 19:28504670-28504692 TTTTTGGCTCCAAATAAGGCAGG - Intergenic
1165957840 19:39512951-39512973 TTCTTGCAGCCTCACATGGCAGG - Intergenic
1166267524 19:41694503-41694525 TTCTTGCCTCGTCATATCTCTGG - Intronic
1167973893 19:53208484-53208506 TGCTTCCTTCCTTATAAGGCAGG + Intergenic
1168669571 19:58230354-58230376 TTTTAGCATCCTCACAAGGCAGG + Intronic
926144221 2:10386928-10386950 CTCTGGCCTCCACATGAGGCAGG + Intronic
926475333 2:13314680-13314702 TCCATCCCTCCTCACAAGGCAGG - Intergenic
928352981 2:30579673-30579695 TTCTTGCCACATAAAAAGGCTGG - Intronic
934890112 2:98060219-98060241 TTCTTGCTTCCTCAGAAGAAAGG - Intergenic
937253337 2:120538043-120538065 CTCTTGGCTCCTCCTAAAGCTGG + Intergenic
937700147 2:124854925-124854947 TACTTGCCTCCTAATATGTCTGG - Intronic
938054552 2:128204377-128204399 TTTTTGCTTCTTCATAAGGAAGG - Intergenic
944280796 2:197894174-197894196 TCCCTGCCTTTTCATAAGGCAGG - Intronic
947951130 2:234148273-234148295 CTCCTGCCTCCTCAGAAGGACGG - Intergenic
948543646 2:238709178-238709200 TTCTTGTCTTCTCATAAACCTGG + Intergenic
948605811 2:239134151-239134173 TTCCTGTCTCCTCCAAAGGCAGG + Intronic
949023500 2:241754174-241754196 TTCTTACCTCCTCATCAGACCGG - Intronic
1170764203 20:19275959-19275981 TTCTTGGCTCCTCATCTGCCAGG - Intronic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1174423835 20:50418148-50418170 TTCCTGCCTCTTCCTAAGACTGG - Intergenic
1174703310 20:52631142-52631164 ATCATGCTTGCTCATAAGGCTGG + Intergenic
1178051720 21:28754897-28754919 TTCTTGCCTCTTCTAAAGCCTGG - Intergenic
1179277679 21:39907215-39907237 TTCTCCCCTCCACATGAGGCAGG + Intronic
1182677671 22:32052566-32052588 TACTTGACTCTTCATAAGCCTGG + Intronic
1182984373 22:34702447-34702469 TTCTTGCCTCATGCTAAGTCTGG - Intergenic
1183249624 22:36720901-36720923 TTCTCTCCTCCTCAGGAGGCTGG + Intergenic
950181840 3:10918885-10918907 TTCTTGGCTTCTCATAGTGCTGG + Intronic
950192197 3:10985103-10985125 TTCTTGCCTCTCCATGGGGCTGG - Intergenic
951515173 3:23550961-23550983 TTCATCCCTACTAATAAGGCAGG - Intronic
952292321 3:32029483-32029505 TTCTTGCCTCCTCAGAAGAAAGG - Intronic
953696751 3:45165850-45165872 TTATTGCCCACTCAAAAGGCTGG - Intergenic
960323169 3:116262874-116262896 TTCTTGGTTCCTCATGTGGCAGG + Intronic
963273765 3:143310355-143310377 TTCTTCCTTCTCCATAAGGCTGG + Intronic
967212366 3:187180216-187180238 TTCTTGCCCCCTAGAAAGGCGGG + Intronic
970061277 4:12037173-12037195 TTCTTGCCTCTTCATGGGACAGG + Intergenic
971135534 4:23864310-23864332 GTCTTGCCTCCTTATACAGCTGG + Intronic
978001315 4:103558435-103558457 TTCTTGCCTCCTAGAAAAGCAGG + Intergenic
978827359 4:113041463-113041485 TTCTTGCCTAGGCATAAGACTGG + Intronic
979358365 4:119732256-119732278 TTCTTGCCTCTTCAGAAGAAAGG - Intergenic
980005863 4:127541911-127541933 TTCTTACCTCCTCAGAAGAAAGG + Intergenic
981591821 4:146372520-146372542 TTCTAGCCTTCTCAGAAGTCAGG + Intronic
984575014 4:181438049-181438071 TTCTGGCCTGCCCATAGGGCTGG + Intergenic
986977129 5:13408050-13408072 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
987837395 5:23179059-23179081 TTCATTCTTCCTCATCAGGCAGG - Intergenic
989738888 5:44745297-44745319 TTCTTGGCTCCTCACATGGCAGG + Intergenic
990167387 5:53009807-53009829 TTGTTGCATCCTCACAAGGCAGG - Intronic
991686345 5:69185726-69185748 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
993361291 5:86980037-86980059 TTCTTGCTTCAACATAAGGGTGG - Intergenic
996266730 5:121550358-121550380 TTCTTGACTCCTGCTAAGGAGGG - Intergenic
1000197919 5:158977847-158977869 CTCCTCCCTCCTCCTAAGGCAGG - Intronic
1003456393 6:6286545-6286567 TTCTTGCCTCCTCATAAGGCAGG - Intronic
1003813274 6:9809281-9809303 TTCTTGCATGCTCACAAGACTGG - Intronic
1005218567 6:23560299-23560321 TTCTTGCCTCCTCAGAAGAAAGG - Intergenic
1005257547 6:24019840-24019862 TCCTTACCTCCTCCTAATGCAGG - Intergenic
1007722114 6:43891196-43891218 TTCTCTGCTCCTCTTAAGGCTGG + Intergenic
1008086668 6:47252804-47252826 TTCTTGCCTCCTGAGGATGCAGG - Intronic
1009657990 6:66570190-66570212 TTCTTGCCTCCTCAGAAGAAAGG - Intergenic
1010185495 6:73139086-73139108 TGCCTGCCTCCTCCTCAGGCTGG + Intronic
1010451465 6:76008523-76008545 TCCTTGCCTCCGCAGAAGGAGGG - Intronic
1012400721 6:98841260-98841282 TTAATGCCTCCTTATCAGGCAGG + Intergenic
1012933300 6:105339143-105339165 TGATTGACACCTCATAAGGCCGG + Intronic
1012961788 6:105630048-105630070 TTCTTGATTGCTCATAAGGGAGG - Intergenic
1013266588 6:108505450-108505472 GTCTTGTCTCCTCATATGCCTGG - Intronic
1017428217 6:154344081-154344103 CTCTAGCCTCCTCATAAAACTGG + Intronic
1020211849 7:6163716-6163738 TTCTTCCCTCCTCGTAGGGAGGG + Exonic
1020794831 7:12666676-12666698 TGCTTGCCTCCTTAGAAGGTAGG + Intergenic
1024138450 7:46434355-46434377 TTCTTGCCGCCTTGTAAAGCAGG + Intergenic
1024222159 7:47297434-47297456 TTTCTGCCTCCTCAACAGGCAGG - Intronic
1024364417 7:48504791-48504813 TTCTGACCTCCTGATAAGGTTGG + Intronic
1024992836 7:55249871-55249893 TTATTGGCTCCTCAAAAAGCAGG + Intronic
1025247300 7:57327008-57327030 TTCCTGCCTCTTCGTAAGACTGG + Intergenic
1029872659 7:103711540-103711562 TTCTTTTCTTCTCTTAAGGCAGG + Intronic
1031043123 7:116859765-116859787 TTCTTTCTTCCTCTTAAGTCTGG - Intronic
1033822381 7:145149883-145149905 TTCTGGCCTGAGCATAAGGCAGG - Intergenic
1035769888 8:2138624-2138646 TTCGTGCCGCCTTAGAAGGCAGG - Intronic
1037142050 8:15531641-15531663 TTCTTGCCTTCTCAGAAGAAAGG - Intronic
1039034440 8:33344537-33344559 TTGGTGCCTGCTGATAAGGCAGG - Intergenic
1039102590 8:33957283-33957305 CTCATGCCTCCTCACTAGGCAGG - Intergenic
1039328621 8:36512506-36512528 TTCTTGCCTCCTCCAACTGCGGG - Intergenic
1042747764 8:72126002-72126024 TTCTTGCCTCCTCAGACAGAGGG - Intergenic
1044681971 8:94788733-94788755 TTCTTGACTCCTGAGAAAGCTGG + Intronic
1044750886 8:95414433-95414455 TTCTTGTCCCCACATGAGGCTGG + Intergenic
1044833055 8:96268929-96268951 TTCTTGCCACCTACTATGGCAGG + Intronic
1044900780 8:96942245-96942267 TTCTTTCATCCCCATAATGCAGG + Intronic
1045309826 8:100991469-100991491 TTCATGCTTCCTCATAAGTGTGG - Intergenic
1045588568 8:103566335-103566357 TTCTTGCTTCCTTATGAGACAGG - Intronic
1046590823 8:116204226-116204248 TTCTTCCCTCCTCGTAGAGCAGG - Intergenic
1047147063 8:122214236-122214258 TTCTTGTGTCCTCACAGGGCAGG - Intergenic
1047270062 8:123349278-123349300 TTCTTACCTCTTTATCAGGCAGG + Exonic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1050190727 9:3023209-3023231 TTTTTGCCTCCCCGTTAGGCAGG + Intergenic
1051235952 9:14999406-14999428 TCCTTGCCTCCTTATAAAACTGG + Intergenic
1051485850 9:17607011-17607033 TTCTCCTCTTCTCATAAGGCCGG + Intronic
1054931911 9:70643923-70643945 TTCATGCCTCCTTATATGGGAGG + Intronic
1056021739 9:82445089-82445111 TTCTAGCCTCCTCCTAGGACTGG - Intergenic
1057683779 9:97215659-97215681 TTCTTGCCTCCTAGGAAAGCGGG - Intergenic
1057949551 9:99359012-99359034 TTCTTGCCTGCTCAGCAGGGCGG - Intergenic
1059193465 9:112348768-112348790 TTCTTGCCTCCTCAGAAAAAAGG - Intergenic
1061946182 9:133909239-133909261 TCATTGCCTCCTCAGAAGGGGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1187036422 X:15545169-15545191 TTCTTGCCTCCTCAAAGGAAAGG + Intronic
1188905724 X:35789036-35789058 TTCTTGCCTCCTCAGAAGAAAGG + Intergenic
1189250302 X:39595815-39595837 TTCTTTCCTCCTCAAATGACGGG + Intergenic
1190227346 X:48556507-48556529 TTCTTTTCCCCACATAAGGCGGG + Intronic
1191223603 X:58016756-58016778 TTTTTGGCTCCTCACAATGCAGG + Intergenic
1194057380 X:89152037-89152059 TTCTTGCCTCCTCACATACCAGG + Intergenic
1194745884 X:97627889-97627911 TTCTAGCCTCCTCATAGGCTTGG - Intergenic
1196387896 X:115178094-115178116 TTCTTGCCTCAGCAGAAGACTGG - Intronic
1198145485 X:133852298-133852320 TTCCTGCCTCCTCTCAAAGCTGG + Intronic