ID: 1003456939

View in Genome Browser
Species Human (GRCh38)
Location 6:6292045-6292067
Sequence TTGAGGTCCCAGCACTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003456932_1003456939 30 Left 1003456932 6:6291992-6292014 CCCTTGGTGGAGGTAGTAAGCAT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG No data
1003456933_1003456939 29 Left 1003456933 6:6291993-6292015 CCTTGGTGGAGGTAGTAAGCATT 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1003456939 6:6292045-6292067 TTGAGGTCCCAGCACTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003456939 Original CRISPR TTGAGGTCCCAGCACTTTCC AGG Intronic
No off target data available for this crispr