ID: 1003459490

View in Genome Browser
Species Human (GRCh38)
Location 6:6317262-6317284
Sequence TCATCCCCATGTTATATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003459490_1003459494 28 Left 1003459490 6:6317262-6317284 CCTAACATATAACATGGGGATGA 0: 1
1: 0
2: 2
3: 26
4: 336
Right 1003459494 6:6317313-6317335 ACTCAGTTCTGTGGCTGTCAAGG 0: 1
1: 0
2: 2
3: 26
4: 239
1003459490_1003459492 19 Left 1003459490 6:6317262-6317284 CCTAACATATAACATGGGGATGA 0: 1
1: 0
2: 2
3: 26
4: 336
Right 1003459492 6:6317304-6317326 TCCTCTTAAACTCAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003459490 Original CRISPR TCATCCCCATGTTATATGTT AGG (reversed) Intronic
901188784 1:7391399-7391421 TCATCCCCTTTTTATAGATTAGG + Intronic
901665416 1:10823483-10823505 TCATCCCCGTCTTATAGGTAAGG + Intergenic
902094613 1:13932619-13932641 TCATCCCCATTTTATAGATGAGG + Intergenic
902221820 1:14971072-14971094 TCATCCCCATTTTATAGATGGGG - Intronic
902410573 1:16209329-16209351 TTATCCCCATTTTATAGGTGAGG + Intronic
902741255 1:18440017-18440039 TCATCCCCATTTTATAGATGAGG + Intergenic
902919388 1:19657155-19657177 TCATCCCCCTGTGGAATGTTGGG + Exonic
903422377 1:23227251-23227273 TTATCCCCATTTTATAGGTGAGG + Intergenic
904068774 1:27776286-27776308 TCATTTCCATGTTATGTATTAGG + Intronic
904131460 1:28278756-28278778 TCAACCCCATGTTATAGATGAGG - Intronic
904141784 1:28359247-28359269 TCATCCCCATTTTATAGATGAGG + Intergenic
904559944 1:31389671-31389693 TTATCCCCATTTTATAGGTAAGG + Intergenic
904968206 1:34397109-34397131 TCATCCCCATTTTATAGCTGAGG + Intergenic
905520306 1:38593930-38593952 GCTTCCCAATGTTACATGTTGGG - Intergenic
907226331 1:52950638-52950660 TCTTGCACATGTTATATGCTAGG + Intronic
907269127 1:53280358-53280380 TCATCCCCATTTTATAGGTGAGG - Intronic
907417403 1:54324041-54324063 TTATCCCCATTTTATAGGTGCGG + Intronic
907534111 1:55133485-55133507 ACCTCCTCATGTTATATATTAGG - Intronic
907790779 1:57661363-57661385 TCATCCCCATTTTATAGTTAAGG - Intronic
909052046 1:70777803-70777825 TCATCTCCATTTTATAAGTGAGG - Intergenic
909093948 1:71263694-71263716 TCTTCCCCATGTAAAATCTTAGG - Intergenic
909585698 1:77285142-77285164 TTATCCCCATTTTATAGATTAGG - Intronic
910006688 1:82405710-82405732 TCATCTCTATATTATATTTTTGG + Intergenic
910208323 1:84769916-84769938 TAATCCCCATTTTATAGGTGAGG + Intergenic
910303232 1:85732092-85732114 TTATTCCCATTTTATATGTGGGG - Intronic
910435496 1:87201632-87201654 TCATCCCCATTTTACAGGTGAGG - Intergenic
910724507 1:90324366-90324388 CCATCACCATTTTATATGTGAGG + Intergenic
910918655 1:92319376-92319398 TTATCCCCATGTTATAGATAAGG - Intronic
911325504 1:96466983-96467005 TCATCCCCATTTTACAGATTAGG + Intergenic
912158675 1:106953952-106953974 TCATCCCCATTTTATTATTTAGG + Intergenic
912265098 1:108149602-108149624 TAATTCCCATGGTCTATGTTTGG - Intronic
912501316 1:110124130-110124152 TCATCCCCATTTTATATTTGAGG + Intergenic
912802101 1:112726362-112726384 TTGTCACCATGTTATAGGTTTGG + Intronic
913288521 1:117250324-117250346 TGATTCCCATGTTATAGGTGGGG - Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
916098572 1:161373486-161373508 TTATCCCCATTTTACATGTAAGG - Exonic
919100769 1:193094672-193094694 TCATTCCCATGTGATAATTTAGG - Intergenic
920409077 1:205744324-205744346 TTATCCTCATTTCATATGTTAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921248418 1:213272246-213272268 TCATCCTCATGTAATATAATAGG - Intronic
921260975 1:213384829-213384851 TCATCCCCATTTCATAGGTGAGG + Intergenic
921848018 1:219904693-219904715 TCTTCCACATTTTATATGTGAGG - Intronic
922485932 1:225972939-225972961 TCATCCCCATTTTACAGGTGAGG - Intergenic
922861952 1:228826510-228826532 TTATCACCATGTTATTTGTTAGG + Intergenic
923014178 1:230113102-230113124 TTACCCCCATGTTATTTGTGTGG + Intronic
923982934 1:239345937-239345959 TCATCCACATTTTATAGGGTTGG + Intergenic
924549222 1:245059051-245059073 TCATCCCCATTTTACAGGTGTGG + Intronic
1065364219 10:24919003-24919025 TTATCCCCATTTTACATGTAAGG - Intronic
1067000528 10:42607472-42607494 TCATCTCTATGTGATATGTCTGG + Intronic
1067339155 10:45387131-45387153 TCATCTCCATTTTACATGTGAGG + Intronic
1067785100 10:49240093-49240115 TCATCCCCATGTGATGGCTTGGG - Intergenic
1067994810 10:51259777-51259799 TCATCCCTTTTTTATATGTGTGG + Intronic
1069212068 10:65774078-65774100 TCATCCTCATGCTGTATATTAGG + Intergenic
1070316440 10:75317678-75317700 TAATAACCATGATATATGTTAGG - Intergenic
1070379093 10:75863575-75863597 TCATCCCCATTTTACAGGTGAGG - Intronic
1070431709 10:76346723-76346745 TTATCCCCATTTTATATATGAGG + Intronic
1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG + Intronic
1071494660 10:86159806-86159828 TCATCCCCATTTTATAGATGAGG - Intronic
1071574120 10:86713613-86713635 TCATCCCTCTGTTATATATAAGG - Intronic
1074100720 10:110353084-110353106 TCATCCCCATTTTAGAGGTGAGG + Intergenic
1074189184 10:111121461-111121483 TCACCCCCATTTTACATGTAAGG + Intergenic
1074297280 10:112201990-112202012 TCATTCCCATGGTACAGGTTAGG + Intronic
1074735486 10:116427392-116427414 TCATCCCCATTTTACAGGTAAGG + Intergenic
1074891167 10:117737679-117737701 TCACCCCCATTTTATAGGTGAGG + Intergenic
1075288654 10:121209248-121209270 TCATCCCTATGGCAGATGTTTGG - Intergenic
1075622202 10:123936201-123936223 TCATCCCCATTTTACAGATTAGG + Intronic
1078539097 11:12199205-12199227 TCATCCCCACTTTATAAGTGAGG - Intronic
1078572151 11:12468539-12468561 GTATCCCCATGTTATCAGTTAGG + Intronic
1079114334 11:17631572-17631594 TTATCCCCATTTTATAGGTGAGG - Intronic
1079394017 11:20045946-20045968 TCATCCCCATTTTACAGGTGAGG - Intronic
1081304436 11:41494310-41494332 ACATCCCCATGTTATAGGTGAGG - Intergenic
1081378118 11:42383678-42383700 TCATCCCCATTATATAGGTGAGG - Intergenic
1081386226 11:42476785-42476807 TTAACCCCATGTTATAGGTAAGG - Intergenic
1081496858 11:43620283-43620305 TCATCCCCATTTTATAGATGAGG + Intronic
1081703248 11:45165024-45165046 TCATCCCCATTTTATGTGGCAGG + Intronic
1081810536 11:45911613-45911635 TCATCCCCATCTTACAGGTGAGG + Intronic
1082986837 11:59176339-59176361 TTATCCCCATTTTATAAGTAAGG + Intronic
1083248326 11:61447715-61447737 TCATCCCCATTTTATAGATGAGG - Intronic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1085937478 11:81166198-81166220 TCATCTTCATTTTATATGTAAGG + Intergenic
1086723533 11:90151215-90151237 TCATTCGCATTTTATATGTGAGG - Intronic
1086816533 11:91379250-91379272 TGATCCACAAGGTATATGTTTGG - Intergenic
1086854139 11:91846249-91846271 TTATCCCCATTTTATAGGTGAGG - Intergenic
1086867928 11:92002533-92002555 TTATCCCCATGTTATAAATAAGG + Intergenic
1087248152 11:95864501-95864523 TCAACCCCATTTTATAGGTGAGG - Intronic
1087344848 11:96958724-96958746 CCATCCCTATGTTAAATTTTTGG + Intergenic
1088076060 11:105849763-105849785 TAATGCCTATGTTATATGTTTGG - Intronic
1088232318 11:107685827-107685849 TCATCCCCATTTTATGTATAAGG + Intergenic
1088464264 11:110116783-110116805 TCATCTCCATTTTATATTTGAGG + Intronic
1088849995 11:113696579-113696601 TCATCACCATTTTACAGGTTAGG - Intronic
1088990035 11:114945504-114945526 TGATCCCCATGTTAAAGGTGAGG - Intergenic
1089007431 11:115104043-115104065 TCCTCCCCATATTATATCTCAGG + Intergenic
1089394932 11:118130504-118130526 TCATCCCCATTTTGCAGGTTAGG + Intergenic
1090069945 11:123535300-123535322 TTTCCCCCATTTTATATGTTAGG + Intronic
1090156596 11:124444626-124444648 TCATCCCCATTTTATAGATGAGG - Intergenic
1090754809 11:129780640-129780662 TCTTCTTCAAGTTATATGTTAGG - Intergenic
1090938626 11:131367931-131367953 TCATCCCCATTTTATAAATGAGG - Intergenic
1091409836 12:232032-232054 GCATCCCCATTTTATAGATTAGG - Intronic
1091645831 12:2271538-2271560 TCATCCCCATTTTATAGATTAGG - Intronic
1093039419 12:14361396-14361418 TCATCCCCATTTTATAGACTGGG + Intergenic
1093625404 12:21340822-21340844 TCATCCTTTTCTTATATGTTGGG - Intronic
1094808541 12:34114731-34114753 TCATCTCCATTGTATATTTTAGG - Intergenic
1095787826 12:46129868-46129890 TCATCCCTAATTTATATATTAGG - Intergenic
1095927356 12:47592243-47592265 TAATCCCCATTTTATGTGTGAGG + Intergenic
1096818011 12:54213968-54213990 CCATCTCCATCTTTTATGTTTGG - Intergenic
1097844069 12:64348660-64348682 TCTTCCTCAGGTTATATTTTAGG + Intronic
1098079810 12:66772108-66772130 TCATCCCCATTTTATAGTTTAGG + Intronic
1099159864 12:79227706-79227728 TCATCCCCATTTTATATAGGAGG - Intronic
1100728218 12:97433036-97433058 TCATCCCCATTTTATAAATGTGG - Intergenic
1102259934 12:111437549-111437571 TCATCCCCATTTTACAGGTGAGG + Intronic
1102925763 12:116825024-116825046 TCCTCCCCATGATATCTGCTGGG + Intronic
1105250505 13:18695136-18695158 TCATCCCCATTTTAGAGATTTGG + Intergenic
1105525164 13:21170745-21170767 TTATCCCCATCTTATAAGTGAGG + Intronic
1105575273 13:21645296-21645318 TCAGCCCCATGCTAGATGCTAGG - Intergenic
1108066352 13:46581583-46581605 TCATCCCCGTGTTAGATGTGAGG + Intronic
1108089036 13:46826512-46826534 TCATCTCCATGTTCTATATAAGG - Intergenic
1109038534 13:57299132-57299154 TTATCCTCATTTTATATGTAAGG + Intergenic
1109325557 13:60863274-60863296 TCATTCTCATTTTCTATGTTTGG - Intergenic
1109509677 13:63353526-63353548 TCTCCCTCATGTTATATTTTAGG - Intergenic
1110958971 13:81595774-81595796 TCATCCCCATGGAATTTGTGGGG + Intergenic
1113053292 13:106238184-106238206 TTATCCCCATGTTATAGATGAGG - Intergenic
1114392934 14:22329636-22329658 TCCACCCTATGTTATATGGTTGG - Intergenic
1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG + Intronic
1116496385 14:45565646-45565668 TCATCCCTATTTTATAGGTGAGG + Intergenic
1118444532 14:65839297-65839319 TCATCCCCATTTTATAGATGGGG + Intergenic
1118923668 14:70172287-70172309 TTATCCCTATCTTATATTTTGGG + Intronic
1119426557 14:74539187-74539209 TCATCCCCATTTTACAGATTAGG + Intronic
1119452338 14:74722488-74722510 TCATCCCTATTTTATAGGTGAGG - Intronic
1119552421 14:75524561-75524583 TCATTTCCATTTTATATGTGAGG - Intronic
1120085826 14:80271541-80271563 TCATCCCCATCTTATAGATGAGG - Intronic
1121000776 14:90450835-90450857 TCCTCCCCATGTTATAGATGAGG - Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1121559415 14:94863714-94863736 TCATCCCCATTTGATATATGGGG - Intergenic
1122930244 14:104929820-104929842 TCATCCCCATTTTATAGGTGAGG - Intronic
1123768562 15:23506162-23506184 TCATCCTCAGGTTATATTTTAGG - Intergenic
1125231125 15:37457312-37457334 TCATCTTCTTGTTATATGCTTGG + Intergenic
1125858809 15:42978030-42978052 TTATAACCCTGTTATATGTTTGG - Intronic
1126426955 15:48537989-48538011 TCATCCCTATTTTGTAGGTTAGG - Intronic
1126729091 15:51663494-51663516 TTCTCCCCATGTTGGATGTTGGG - Intergenic
1128136914 15:65270645-65270667 TCATCCCCATTTTATAGATGAGG + Intronic
1128382142 15:67121013-67121035 GAATCCCCATCTCATATGTTGGG + Intronic
1129713023 15:77830862-77830884 TCATCCCCATTTTATAAATGAGG + Intergenic
1131433584 15:92405723-92405745 TCATCACTTTGTTGTATGTTTGG + Intronic
1131625293 15:94112115-94112137 TCATCCCCATATTATAGATGAGG + Intergenic
1133406557 16:5529178-5529200 TCATTCCCATTTTATAGGTGGGG - Intergenic
1133536138 16:6704164-6704186 TCATCCCCATGTTGTGTGTAAGG + Intronic
1133742620 16:8662877-8662899 TCCTTGCCCTGTTATATGTTAGG - Intergenic
1134867140 16:17618501-17618523 TCATCCCCATTTTATAAATAAGG + Intergenic
1135911780 16:26567845-26567867 TCATCCCCATTTTACAGGTAAGG + Intergenic
1135985748 16:27182763-27182785 TCATCCCCATTTTACAGGTAGGG + Intergenic
1138505491 16:57476337-57476359 TCATCCCCATTTTATAGATGGGG + Intronic
1138935419 16:61715051-61715073 TCAAGCACATGTTATATGATAGG + Intronic
1140126170 16:72120609-72120631 TCATCCCCATTTTACAGATTAGG + Intronic
1141750918 16:85957348-85957370 TCATCCCCATTTTATAGCTGGGG + Intergenic
1141866951 16:86756928-86756950 TCATTCCCATTTTATATATGAGG + Intergenic
1143788618 17:9275563-9275585 TTATCCCCATCTTATAGGTGAGG - Intronic
1144808951 17:17986283-17986305 TCATCCCCATTTTATAGATGAGG - Intronic
1147601900 17:41751872-41751894 TCATCCTCATTTTACATGTGAGG + Intergenic
1148674422 17:49436913-49436935 TCATCCCAATTCTATATTTTTGG - Intronic
1149231481 17:54539613-54539635 TCATTCCAATTTTATTTGTTTGG - Intergenic
1149325557 17:55526473-55526495 TTATCCCCATGTTATAGATGAGG + Intergenic
1150343770 17:64388495-64388517 TCATCCCCATGTTACAGATTGGG + Intronic
1153208195 18:2727681-2727703 TCATCCCCATTTTACAGGTAAGG - Intronic
1153996825 18:10450097-10450119 TTATCCCCATGTTATAGATGGGG + Intergenic
1154260047 18:12823365-12823387 TTATCCCCATGTCAAAAGTTAGG + Intronic
1155311591 18:24529620-24529642 TTATCCCCATTTTATAAATTGGG - Intergenic
1155995564 18:32327856-32327878 ACATCCCCATTTTATATGTGAGG - Intronic
1157150694 18:45214606-45214628 CCATCACCATGTTAGATGTTGGG + Intronic
1157346309 18:46838328-46838350 CCATCCCCATGTTATAAATAAGG + Intronic
1157485847 18:48086293-48086315 TCATCCCCATTTTATAGGTGAGG + Intronic
1157917346 18:51678971-51678993 TGATCCCCATGTGATATGGGAGG + Intergenic
1161616908 19:5276019-5276041 CCATCCCCATTTTACATGTGAGG + Intronic
1166244262 19:41514687-41514709 TCATCCCCCTGTAATATTGTTGG - Intergenic
924966327 2:79890-79912 ACAGGCCCATGTTACATGTTAGG - Intergenic
925498400 2:4478337-4478359 TCATCCCCATTTTAAAAGTAAGG + Intergenic
926036233 2:9638103-9638125 TCATCCCCATTTTATAAATGGGG - Intergenic
928330635 2:30355441-30355463 TTATCCTCATTTTATAGGTTAGG + Intergenic
929654605 2:43717777-43717799 TTATCCCCATTTTATAGGTGAGG - Intronic
929763838 2:44827934-44827956 TCATCTCCATTTTATACGTGGGG - Intergenic
929915084 2:46128455-46128477 TTATCCCCATTTTATGGGTTAGG + Intronic
930928423 2:56850452-56850474 TCTTCTCCAAGTTAAATGTTGGG + Intergenic
931767637 2:65471005-65471027 TAATCCCCATGTTAATGGTTAGG + Intergenic
931945393 2:67300563-67300585 TCATCCCCGTGTTATAAATGAGG - Intergenic
933464768 2:82638682-82638704 TAATCCCCATGTTACATGGAAGG + Intergenic
935034973 2:99361529-99361551 TCATTCCCACTTTCTATGTTAGG - Exonic
935579496 2:104744371-104744393 CCATGCCCATCTTATAGGTTAGG - Intergenic
935710593 2:105894763-105894785 TCATCCCCATTTTATAGATGGGG + Intergenic
936923064 2:117708889-117708911 TTATCCCCATGTTATAGATGAGG + Intergenic
937720941 2:125095492-125095514 TTATCCCCATTTTATAAGTGGGG - Intergenic
938100453 2:128494472-128494494 TCATCCCCATTTTACATGTGAGG - Intergenic
940728094 2:157358637-157358659 TTATCCCCATGTTATGGATTAGG + Intergenic
944134905 2:196388485-196388507 TCATTCCCATGTTACCTGTGGGG + Intronic
945076548 2:206045612-206045634 TTTTCCCCATGTTATGTCTTCGG - Intronic
945420131 2:209625529-209625551 TCATCCCCATTTTAGAGATTAGG + Intronic
947045528 2:225978533-225978555 TAATCCCCATGTTTTATGGGAGG - Intergenic
947788489 2:232846765-232846787 TTATCCCCATTTTATAAATTAGG + Intronic
947847184 2:233254005-233254027 TCATCCCCATTTTATAGATGAGG - Intronic
947857766 2:233335847-233335869 ACCTCCCCATGTGATATGCTGGG + Intronic
949064045 2:241978880-241978902 TCTGCCCCATGTGATATGTCTGG - Intergenic
1169487859 20:6048279-6048301 TCATCCCGATGTTAAAAGTTGGG + Intronic
1169941731 20:10945070-10945092 TTATACCCATTTTATATGTGAGG - Intergenic
1170271294 20:14529902-14529924 TCTTTCCCATGTTTTAGGTTGGG + Intronic
1170309761 20:14979909-14979931 TCATCCCTATTTTATAGATTGGG - Intronic
1170365356 20:15592152-15592174 TTATCCCCATTTTATAGGTAAGG - Intronic
1172282323 20:33716690-33716712 TCAAGCACATGTTATATGTCAGG - Intronic
1172792818 20:37518012-37518034 TGATCCCCTTGATAGATGTTTGG - Exonic
1174037681 20:47678265-47678287 TCATCCCCATTTTACCAGTTTGG - Intronic
1174550158 20:51356356-51356378 TCATCCCCATTTTACAGGTGGGG - Intergenic
1174555905 20:51395215-51395237 TCATCCCCATTTTATAGATGGGG + Intronic
1174798950 20:53546630-53546652 TCATCCCCATTTTATAGATGAGG - Intergenic
1175192923 20:57223632-57223654 TCATCCCCATTTTACAGGTGCGG - Intronic
1177678256 21:24331446-24331468 TCATCTTCACTTTATATGTTTGG + Intergenic
1179080600 21:38167184-38167206 TCATCCCCATTTTACATATGAGG + Intronic
1182093040 22:27609053-27609075 TCATCCCCATTTTACAGGTGAGG + Intergenic
1183545260 22:38452054-38452076 TCATCCCCATTTTACAGGTGGGG + Intronic
949125049 3:437121-437143 TCAACTCCATGATATATTTTTGG + Intergenic
950284051 3:11731000-11731022 TCATCCCCATCATATAGGTGAGG - Intergenic
950716511 3:14851302-14851324 TCATCTCCATGTTATAGATGAGG + Intronic
951824861 3:26857747-26857769 TTATCCCCATTTTATAGGTGAGG + Intergenic
952961235 3:38590468-38590490 TTATCCCCATTTTATATATGAGG - Intronic
953044600 3:39283204-39283226 TTATCCTCATCTTATATGTGAGG + Intergenic
953814933 3:46147401-46147423 TCATCACCATACTGTATGTTAGG - Intergenic
954306869 3:49731574-49731596 TCATTCCCATGTTATAGATGAGG - Intronic
954525778 3:51269879-51269901 TCATCCCCATTTTATAGATGGGG + Intronic
955198172 3:56825111-56825133 TCATCCCCATTTTATAGGCGAGG - Intronic
955506873 3:59641294-59641316 TCATCCCCATTTTATAGATGAGG + Intergenic
955616358 3:60811661-60811683 TCATTTCCATGTTATATGTGAGG - Intronic
955641249 3:61087456-61087478 TTATCCCCATTTTATAGTTTAGG - Intronic
955968402 3:64412604-64412626 TCATCCCTTTCTTTTATGTTTGG + Intronic
957891718 3:86367504-86367526 TGATCCCTGTGTTATATTTTGGG - Intergenic
962478497 3:135778473-135778495 TCATCCTCATTTTGTATATTAGG + Intergenic
962674443 3:137744317-137744339 TCATCTCCATTTTATAGCTTAGG + Intergenic
965499252 3:169438052-169438074 TCATCCCCATTTTATATGTAAGG + Intronic
966396730 3:179511241-179511263 TTTTCCACATATTATATGTTTGG + Intergenic
966674543 3:182571342-182571364 TCATCTCCATTTTATATATGAGG - Intergenic
966939487 3:184736497-184736519 TCATCCCCATTTTATAGATGAGG + Intergenic
967948774 3:194824426-194824448 TTATCCCCAAGTTATAGATTAGG - Intergenic
968220449 3:196934157-196934179 TCATCCCCAAATTATGTTTTTGG + Exonic
969193478 4:5542664-5542686 TCATCCCCATTTTATAGATGGGG - Intergenic
970054523 4:11955681-11955703 TAATTCCCATGTTGTATGTTAGG + Intergenic
970271742 4:14355339-14355361 TCATCCCCATTTTATAAATGTGG - Intergenic
970274752 4:14386328-14386350 TAATCCCCATGCTATATTGTTGG - Intergenic
970346882 4:15160881-15160903 TAATCCCCATTTTATATATAAGG + Intergenic
970651436 4:18183128-18183150 TTATCCCCATTTTATAGGTGTGG + Intergenic
970754235 4:19405089-19405111 TCATCCCCATTTTATAGATCAGG + Intergenic
970893990 4:21080241-21080263 TAATCCCCATATTATAGGTGAGG - Intronic
971104809 4:23512685-23512707 TGATCACCATGTTATACTTTAGG + Intergenic
971150644 4:24027995-24028017 TCATCCCCATTTAATAGGTGAGG + Intergenic
971525824 4:27617561-27617583 TCATCCCCATTGTATATATAAGG + Intergenic
972364631 4:38362906-38362928 TCATCCCCATTTTAAGAGTTTGG + Intergenic
973023331 4:45232759-45232781 TTATCCCCATTTTATCTGTGAGG - Intergenic
973106881 4:46350309-46350331 CCAGCCTCATGTTAAATGTTTGG + Intronic
974584407 4:63853564-63853586 TCAACTCCATGATTTATGTTTGG + Intergenic
976960153 4:90960901-90960923 TTATCCCCATTTAATATGTGAGG + Intronic
977609042 4:99013847-99013869 TCATTCCCCGGTTAAATGTTAGG - Intronic
977610070 4:99021928-99021950 TCATTCCCCGGTTAAATGTTAGG - Intronic
978806163 4:112802830-112802852 TCCTCCCGAGGTGATATGTTAGG + Intergenic
979940854 4:126760584-126760606 TAATCCCCTTGTTGTATATTTGG + Intergenic
982037517 4:151360935-151360957 TTATCTCCATTTTATATGTGTGG + Intergenic
982285096 4:153725711-153725733 TTATCCTCATGTTATAAATTAGG - Intronic
984581439 4:181514930-181514952 TTATCCCTATTTTATATGTCAGG + Intergenic
985165432 4:187089341-187089363 TCATCCTCATTTTATAGGTGAGG + Intergenic
987351407 5:17025456-17025478 TCATCCCCATTTTATAAGTAAGG - Intergenic
987427025 5:17785238-17785260 AATTCCGCATGTTATATGTTAGG - Intergenic
987803812 5:22734803-22734825 TCATTTCCATTTTATATTTTAGG - Intronic
989669355 5:43896941-43896963 TCATCCCCATTTTATAGATGAGG + Intergenic
989796574 5:45481887-45481909 TCATCCCCATTTTATAAATGAGG - Intronic
990605958 5:57410430-57410452 TCATCCCCATCTTAAAGGTAAGG + Intergenic
992635410 5:78721645-78721667 TCTTCCCCGTGTTATTTTTTTGG - Intronic
994314620 5:98318038-98318060 TTATCCCAATTTTATATATTAGG + Intergenic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
995647845 5:114332890-114332912 TCCTTCCCAGGTTATATTTTGGG - Intergenic
997383456 5:133454062-133454084 TTATCCTCATGTAATATATTTGG - Intronic
998218210 5:140253546-140253568 TCATTCCCAGGTTATCTGGTAGG - Intronic
998785880 5:145708181-145708203 ACATCCCTGTTTTATATGTTGGG + Intronic
1000086076 5:157888465-157888487 TTATCCCCATGTTATAAATTAGG - Intergenic
1000910204 5:167012799-167012821 TGCTCCCCATGGTATATGCTTGG - Intergenic
1001235323 5:170024429-170024451 TCATCCCCATGTTACAAATGAGG - Intronic
1001245172 5:170100810-170100832 TTATCCCCATTTTACAGGTTAGG + Intergenic
1002037081 5:176480111-176480133 TTATTTCCATGTTATATGCTGGG - Intronic
1003459490 6:6317262-6317284 TCATCCCCATGTTATATGTTAGG - Intronic
1004241751 6:13929371-13929393 TGATCACCATGTGATGTGTTGGG + Intronic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1007138710 6:39549425-39549447 TTATCCCCATGTCATAGGTGAGG + Intronic
1007557318 6:42777303-42777325 TCATCCCCATTTTATAGATGAGG + Intronic
1008014103 6:46498747-46498769 TCTTTTCCATGTTATATGTGAGG + Intergenic
1009964265 6:70562209-70562231 TCAAACCCATTTCATATGTTTGG - Intergenic
1013142188 6:107348261-107348283 TCATCTCCATCTTATAGGTGAGG + Intronic
1014171763 6:118286879-118286901 TCATCACCATGCTGTATGTTAGG + Intronic
1014662968 6:124196383-124196405 TATTCCCCATATTATATATTTGG + Intronic
1015680405 6:135801433-135801455 TACTTCCTATGTTATATGTTAGG + Intergenic
1018068947 6:160144121-160144143 TCATCCCCATATTACATATGAGG + Intronic
1018153934 6:160967541-160967563 TTATCCCCATTTTATAGGATGGG - Intergenic
1021625150 7:22585890-22585912 TCATCACCATTTTATAGGTGAGG + Intronic
1022221369 7:28316876-28316898 TCATCCCCCTTTTAAAGGTTAGG - Intronic
1022317547 7:29259636-29259658 TAGTCACCATGCTATATGTTAGG - Intronic
1022552465 7:31254213-31254235 TCATCCCTATGCTGTATATTAGG + Intergenic
1022642074 7:32196473-32196495 TCATCACCATGTTGTTTCTTGGG + Intronic
1022788717 7:33665057-33665079 TTATCTCCATTTTATAGGTTAGG + Intergenic
1023236576 7:38096228-38096250 TCATCACCATGCTATATGTTAGG - Intergenic
1023467760 7:40476109-40476131 TCATCCCCATTTTACATATGAGG - Intronic
1026191357 7:68131060-68131082 TCATCCCCATTTTACATTTGAGG - Intergenic
1026443917 7:70467656-70467678 TTATCCCCATTTTATATGTGAGG + Intronic
1026609020 7:71840683-71840705 TTATCCCCATTTTATATATAAGG - Intronic
1027448449 7:78301913-78301935 TCACCCCCATTTTATAGATTGGG - Intronic
1028756163 7:94436660-94436682 TCATCCCCATTTAATAGATTAGG - Intergenic
1030004945 7:105108679-105108701 TCATCCCCATTTTATAGATGAGG - Intronic
1031421177 7:121553181-121553203 TCATCTCCATGTTGTTCGTTTGG + Intergenic
1031993822 7:128215681-128215703 TCCTCCCCCTCTTATTTGTTGGG + Intergenic
1032302419 7:130699989-130700011 TGAACCTCATGTTATATTTTGGG + Intergenic
1032548282 7:132761744-132761766 TCATCCCCATTTTATAGATGGGG + Intergenic
1032918567 7:136519731-136519753 TTTTCCCCATATTATATATTTGG + Intergenic
1034859402 7:154582922-154582944 TCTTCCCCATGTTATCCATTAGG + Intronic
1035043755 7:155950753-155950775 TCATTCACATTTTATTTGTTTGG + Intergenic
1036120543 8:6012762-6012784 TCATCCCCAGGTCATTTGTGTGG + Intergenic
1036199996 8:6762658-6762680 CCATCCCCATGTTTTATCATTGG + Intergenic
1036593196 8:10187428-10187450 TCTGCCGCATGTTGTATGTTAGG + Intronic
1037027965 8:14062817-14062839 TCATCCCCACGATGTAAGTTTGG + Intergenic
1037269037 8:17105158-17105180 TTATCCCCATGTTATAGATGAGG + Intronic
1038712772 8:29963261-29963283 TCATCCCCCTGGTATCTGTAGGG - Intergenic
1038717299 8:30003364-30003386 TTATCCTCATGTCATATATTTGG - Intergenic
1041537966 8:58949075-58949097 TCATCCCTATTTTATAGCTTTGG - Intronic
1042516063 8:69661014-69661036 TCAGCTCCATTTTATAAGTTTGG - Intergenic
1042895749 8:73665721-73665743 TCATCCCTAGGTTATCTGTGGGG + Intronic
1043978604 8:86611941-86611963 TTATCCCCATTTTACAGGTTAGG - Intronic
1044384203 8:91567762-91567784 TCACCACCATGTTATATGGGAGG - Intergenic
1045574893 8:103409879-103409901 TTATCCCCATTTTATAAGTGAGG - Intronic
1045896793 8:107228238-107228260 TCATCCCCATGTAGAATTTTAGG + Intergenic
1045907182 8:107360470-107360492 TCAGCCCCATGTTCTTGGTTAGG + Intronic
1046473688 8:114712756-114712778 TAATCCCCAGGTTAGAAGTTAGG - Intergenic
1046519395 8:115304926-115304948 TCATCCCCAAAAGATATGTTGGG - Intergenic
1047999294 8:130364417-130364439 TATTCCCCATGTTATATGCATGG + Intronic
1048047247 8:130784387-130784409 TTATCCCCATTTTATAGATTTGG - Intronic
1048516258 8:135114220-135114242 TCATCTCCAGGTGAGATGTTGGG + Intergenic
1049131068 8:140842529-140842551 TTATCCCCATTTTACACGTTTGG + Intronic
1049921314 9:367063-367085 TCATCCCCATGTCACAAGTGAGG - Intronic
1050206497 9:3201937-3201959 ACATCCCCATTTTATAGGTAAGG + Intergenic
1051106136 9:13582573-13582595 TAATGCCCATCTTATATTTTGGG - Intergenic
1052387309 9:27837127-27837149 AAATGCCCATGTGATATGTTAGG - Intergenic
1055556081 9:77475452-77475474 TCATCCCCAGGATACATTTTAGG - Intronic
1055790261 9:79915883-79915905 TTATCCCCATTTTACATGTGAGG + Intergenic
1059366057 9:113787304-113787326 TCATCCTCATTTTATAGGTAGGG + Intergenic
1059991733 9:119871739-119871761 TTATCCCCATGTTATAAATAGGG + Intergenic
1060354838 9:122895798-122895820 TTATCCCCATTTTACAAGTTAGG - Intronic
1060758963 9:126232969-126232991 TTATCCCCATGTTACAGGTGAGG + Intergenic
1060851624 9:126881498-126881520 TCATCCCTACCTAATATGTTAGG + Exonic
1186444152 X:9611826-9611848 CCATCCCCATTTTATATGTGAGG + Intronic
1186520716 X:10204381-10204403 ACATTCCAATGATATATGTTTGG - Intronic
1186591669 X:10936611-10936633 TCATCTCCAGGGTATCTGTTTGG - Intergenic
1186600264 X:11029218-11029240 TAGTCCCCATGTTTTCTGTTTGG + Intergenic
1186911325 X:14170256-14170278 TCATCCTGATTTTATATATTTGG + Intergenic
1187526409 X:20059050-20059072 TCATCCCCATTTTATAGGCAAGG - Intronic
1188092758 X:25983271-25983293 TTATCCCCATTTTACATATTTGG + Intergenic
1192119275 X:68439597-68439619 TCATCCTCACTTTATATGTGAGG + Intergenic
1194187067 X:90784902-90784924 TTATCTCCATTTTATATATTTGG - Intergenic
1194674222 X:96774113-96774135 TCACCCCCATTTTATAGATTAGG + Intronic
1195159956 X:102161629-102161651 TGATCCCAATGTTAGAGGTTGGG - Intergenic
1195644960 X:107220439-107220461 TCATCCTGATGTTTGATGTTAGG + Intronic
1196685296 X:118505422-118505444 TCATCCCCAGGCTTTATGGTGGG + Intronic
1196694631 X:118598516-118598538 TCATCTCCATTTTATAGGTGAGG + Intronic
1198829287 X:140731526-140731548 TCATCCCCAATTTATAAGTGAGG - Intergenic
1200533654 Y:4366978-4367000 TTATCTCCATTTTATATATTTGG - Intergenic
1200757194 Y:7001059-7001081 TCATCCCCATTTTATAAGTGAGG + Intronic
1201645782 Y:16230077-16230099 TTATCCCCACGTTGTATGTGGGG - Intergenic
1201657031 Y:16355239-16355261 TTATCCCCACGTTGTATGTGGGG + Intergenic