ID: 1003459997

View in Genome Browser
Species Human (GRCh38)
Location 6:6320489-6320511
Sequence GCCCAGAGCAAGCCGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003459994_1003459997 -3 Left 1003459994 6:6320469-6320491 CCTGTGACCGGCGCCACAGGGCC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 140
1003459995_1003459997 -10 Left 1003459995 6:6320476-6320498 CCGGCGCCACAGGGCCCAGAGCA 0: 1
1: 0
2: 0
3: 47
4: 345
Right 1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 140
1003459990_1003459997 20 Left 1003459990 6:6320446-6320468 CCAGGATTGGGCAAGTGGAGCTG 0: 1
1: 1
2: 0
3: 14
4: 191
Right 1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003459997 Original CRISPR GCCCAGAGCAAGCCGCTTGC TGG Intronic
900371213 1:2333003-2333025 TTCCAGAGCAAGCCCCTTGGGGG - Intronic
901043201 1:6378458-6378480 GGCCAGAGCATTCCTCTTGCTGG - Intronic
902335053 1:15749786-15749808 GCACAGGGCCAGCCCCTTGCCGG + Intergenic
902931025 1:19731627-19731649 GCCCAGCACCAGGCGCTTGCAGG - Intronic
903847796 1:26288855-26288877 CCCCAGATCATGCAGCTTGCAGG + Intronic
904470287 1:30731837-30731859 GGCCAGAGAAAGCCTCTTGGAGG - Intergenic
904974374 1:34444633-34444655 GGCCAGAGGAAGCCGTGTGCAGG - Intergenic
907872314 1:58454424-58454446 TCCTAGAGCCAGACGCTTGCAGG + Intronic
909643000 1:77888215-77888237 CCCCAGAGCAAACTGGTTGCGGG + Intergenic
915866426 1:159504383-159504405 GCAGAGAGCAAGCAGCTTCCAGG + Intergenic
916501693 1:165393023-165393045 TCCCGGAGAAAGCCGCTTCCAGG - Intergenic
920669131 1:207989610-207989632 GACCAGAGAAAGCTGCTTGGAGG - Intergenic
922867223 1:228870427-228870449 GCTCAGACCAAGCTGCTTGTTGG + Intergenic
1064612354 10:17116450-17116472 GCCCAGAGGTTGCCGATTGCCGG + Intronic
1067094884 10:43293914-43293936 GCCCAGAGCAAGACCCTGGGGGG - Intergenic
1069932445 10:71891843-71891865 GCCCAGAGCTGGGCACTTGCCGG - Intergenic
1074929226 10:118106674-118106696 GCCAAGACCAAGCAGCTTTCGGG - Intergenic
1075729782 10:124629249-124629271 GCCCAGAGGAAGCCTCATGTGGG - Intronic
1076320944 10:129580936-129580958 GCCCAGATCCAGCCGCTGTCTGG + Intronic
1077200017 11:1302075-1302097 GCCTGGAGCAGGCCCCTTGCAGG - Intronic
1081583312 11:44367046-44367068 GCCCAGTGCAAACTGCTTCCAGG + Intergenic
1083228832 11:61302227-61302249 TCCCAGAGCCATCCCCTTGCTGG - Intronic
1088571751 11:111229718-111229740 GCCGAGAGCAAGCTGATTGTGGG + Intergenic
1088768977 11:113014288-113014310 GCTCAGGGCAAGCCGTTTGATGG + Intronic
1089831788 11:121335518-121335540 GCCCAGAGCCAGCAGCTTTAGGG + Intergenic
1090162376 11:124509594-124509616 GCCCAGTTCAGACCGCTTGCCGG + Intergenic
1091241195 11:134053601-134053623 GCCCAGAGCAGAAAGCTTGCAGG + Intergenic
1091304576 11:134529467-134529489 GACCAGAGGAAGCCGCTGGTAGG - Intergenic
1091805238 12:3351185-3351207 GCCCAGATCTAGCTGCTTGAAGG - Intergenic
1094062282 12:26327007-26327029 ACCCAGAGGAAGGCGCTTGGAGG - Intergenic
1096510472 12:52125205-52125227 GCCCACAGCAGGGCTCTTGCAGG - Intergenic
1101750086 12:107576376-107576398 CCCCAGATCAAGCTGCTGGCAGG + Intronic
1101772118 12:107761103-107761125 GCCCAGAGGAGGCCGCGGGCCGG - Exonic
1101800364 12:108016586-108016608 CCCCAGAGCAGGTCTCTTGCAGG - Intergenic
1101943263 12:109116583-109116605 CCCCAGAGTAAGCAGCTAGCAGG + Exonic
1103141659 12:118554025-118554047 GCCCAGGGCAGGCTGCTTCCTGG + Intergenic
1104109933 12:125695372-125695394 GCCCTGAGCAAGGAGCTTGTGGG - Intergenic
1104555606 12:129797418-129797440 ACCCAGAGCATGCAGTTTGCAGG + Intronic
1105356312 13:19663243-19663265 TCCTAGAGTCAGCCGCTTGCAGG + Intronic
1111965698 13:94859359-94859381 GTCCTGAGGAAGCCGCTGGCAGG + Intergenic
1113388089 13:109869825-109869847 GCGCAGAGCCAGCTGCTGGCTGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1117453240 14:55872663-55872685 GCCATGAGCGAGCCACTTGCAGG - Intergenic
1118319219 14:64743401-64743423 CCCCAGAGCAAGCCGGATGGAGG + Exonic
1119407080 14:74405658-74405680 GCCTAGAGCAAGCCAAATGCAGG + Intergenic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121330547 14:93046911-93046933 GCCCAGAGCAGGCGGCTGGTAGG + Intronic
1124212160 15:27772069-27772091 GAGCTGAGCAAGCCGCCTGCGGG + Intronic
1124720435 15:32106955-32106977 GCCCTAAGCAAGCCACTAGCCGG - Intronic
1125749505 15:42019182-42019204 GCCTGGAGCAAGCTGCTAGCTGG - Intronic
1126675484 15:51156591-51156613 TCCCACAGCAGGCCTCTTGCTGG - Intergenic
1134266518 16:12697443-12697465 GCCCAGAACAAGCCTCCTGAAGG - Intronic
1144933183 17:18876838-18876860 GCCTAGAGCAAGCCCCTTAGCGG + Intronic
1147906374 17:43825690-43825712 ACCCAGAGCAAGGCACTTCCTGG - Intronic
1151244271 17:72782319-72782341 CCCCGGAGCAAGCTGCCTGCAGG - Intronic
1151724008 17:75874425-75874447 GCCCAGAGGAGGCAGCTTCCTGG + Exonic
1151853220 17:76703866-76703888 GCCCAGAGAAAACCCATTGCAGG - Intronic
1152227799 17:79100750-79100772 GCTCAAAGCAGGCCCCTTGCCGG + Intronic
1153744767 18:8166294-8166316 GCCCAGGGAAAGCGGGTTGCAGG - Intronic
1155325028 18:24656575-24656597 ACCCAGAGCCAGCTGTTTGCAGG + Intergenic
1156446786 18:37242581-37242603 GCCAAGAGCAAGATGCTTGCTGG + Intergenic
1164980066 19:32607277-32607299 GCCCAGAGCAAGGCACTGTCGGG + Intronic
1165892987 19:39125934-39125956 GCCCACCGCAAGCCCCTGGCCGG - Intronic
1166750475 19:45162005-45162027 TCCCAGAGCAACCGGCTTGAAGG - Intronic
1168097631 19:54124561-54124583 GCCCAGCGCAAGACGCTGTCGGG + Exonic
926227776 2:10980701-10980723 GCCCAGAGCAGGCCCCTGGCTGG - Intergenic
927141525 2:20134454-20134476 GCCCAAAGCAAGCAGGATGCTGG + Intergenic
927982215 2:27381050-27381072 GCCCAGAGCGAGCTGCTGGTAGG - Intergenic
933242365 2:79936475-79936497 GGCCAGAGGATGCCGGTTGCAGG - Intronic
936053331 2:109242038-109242060 CACCAGAGCCAGCCACTTGCAGG - Intronic
937201371 2:120206421-120206443 ACCCAGGGCAAGCCACTTGGGGG + Intergenic
938314835 2:130318230-130318252 GCACAGTGCCAGCCGCTCGCTGG - Intergenic
942104301 2:172617470-172617492 TCCAAGAGCAAGCCACTGGCAGG + Intergenic
942642193 2:178072172-178072194 GCCCACAGCCAGCCCCTTCCCGG - Exonic
946770532 2:223084304-223084326 GCCCAGAGCAAGACAGTGGCAGG - Intronic
948640980 2:239375844-239375866 GCCCAGCCCAGGCCTCTTGCCGG + Intronic
1173974248 20:47175137-47175159 GCCCACAGCCAGCGGCATGCCGG + Intronic
1174053348 20:47782443-47782465 GCCCAGAGAAAGCAGGTTTCAGG + Intronic
1175181063 20:57147985-57148007 GCCCAGTGCAAGGCAGTTGCTGG - Intergenic
1175413225 20:58785098-58785120 GCCCAGAGCAAGATGCTGGTGGG + Intergenic
1175959608 20:62628839-62628861 GCCCAGACCCAGCCCCCTGCAGG + Intergenic
1176180301 20:63746734-63746756 TCCCAGAGCACCCCTCTTGCTGG + Exonic
1176300246 21:5095853-5095875 GCCCAGTGCAGGCCGTGTGCAGG - Intergenic
1179190069 21:39115939-39115961 GCCCAGGTCAAGCTCCTTGCAGG - Intergenic
1179856776 21:44166058-44166080 GCCCAGTGCAGGCCGTGTGCAGG + Intergenic
1180154523 21:45971542-45971564 GCCCAGAGCAAGGCCCTCCCAGG - Intergenic
1183266603 22:36830360-36830382 GCCCTGAGCAAGCAGCTCCCTGG + Intergenic
1184731599 22:46373775-46373797 GTCCAGAGCAGGCCGGTTGGGGG - Intronic
1184811026 22:46832107-46832129 GCCCAAACCCAGCCTCTTGCTGG - Intronic
950437144 3:12986825-12986847 GCCCACAGCAAGCCCCTGCCGGG - Intronic
952334360 3:32391984-32392006 GCCCAGCGCGAGCCCCTTGGAGG + Exonic
953869734 3:46615869-46615891 CCCCAGAGCAAGCTGCTTTGAGG - Intronic
955825150 3:62938205-62938227 GTCCACAGCAAGTAGCTTGCTGG + Intergenic
956179058 3:66500810-66500832 GCCCAGAGGAAGATGCCTGCCGG - Exonic
961044091 3:123696910-123696932 GCCCAGAACAAGCTGTTAGCAGG + Intronic
961216151 3:125162263-125162285 GCCCACAGCAAGCCCCGTGCTGG + Intronic
961312685 3:126013804-126013826 GCCCAGAGCAAGTGGCTTTAGGG + Intronic
961361497 3:126370915-126370937 GCCCAGAGCATGCACCTTCCTGG + Intergenic
962164884 3:133038483-133038505 GCCCAGCCTAACCCGCTTGCCGG - Intronic
963787381 3:149548568-149548590 ACTCAGAGCCAGCCCCTTGCAGG - Intronic
967833274 3:193940536-193940558 GCCCACAGCAAGCCTGTGGCAGG - Intergenic
968443799 4:638041-638063 GAACAGAGCAAGCCGCCTTCTGG - Intronic
968489634 4:883123-883145 GCTCTGAGGATGCCGCTTGCCGG - Intronic
968657906 4:1786565-1786587 GGCCAGAGCAGGCTTCTTGCAGG + Intergenic
969639616 4:8389024-8389046 GCCCAGGACAAGCTGCATGCGGG + Intronic
972245921 4:37245121-37245143 TCCCAGAGAAAGCCGCCCGCCGG - Exonic
972710727 4:41591915-41591937 GCACAGAGCAAGCAGCTTTCTGG - Intronic
979545210 4:121932631-121932653 GCTCAGAGTGAGACGCTTGCTGG + Exonic
985480779 5:108974-108996 GCCCAGAGCGAGCCTCCTGGGGG + Intergenic
986267619 5:6203980-6204002 GCACAAAGCAAACTGCTTGCAGG - Intergenic
990033556 5:51291862-51291884 GGCCAAAGTAAGCCGCTTCCTGG + Intergenic
990989990 5:61675168-61675190 GCCTGGAGCAATCCTCTTGCTGG + Intronic
992088886 5:73300784-73300806 GCTCAGAGCAAAGCGATTGCAGG - Intergenic
992563189 5:77972717-77972739 GCCCAGAGCAGGCCGCAGCCTGG + Intergenic
995481772 5:112600415-112600437 GCCCTGAGCCAGCCTCTTTCTGG - Intergenic
1000808390 5:165827241-165827263 TCCCATAGCAAGCAGCTTGCGGG - Intergenic
1003459997 6:6320489-6320511 GCCCAGAGCAAGCCGCTTGCTGG + Intronic
1003643037 6:7891654-7891676 GCCCAGAGCCAGCTGCTCCCAGG + Exonic
1006097635 6:31665898-31665920 GCCCGGAGGAGGGCGCTTGCGGG - Exonic
1018738138 6:166705221-166705243 GCCAAGAGCAAGGCGCCAGCTGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1027007331 7:74706351-74706373 GCCCTGATCAAGCCACGTGCTGG - Intronic
1029016193 7:97317203-97317225 GCCCAGAGCAAACTGGATGCTGG - Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1034533521 7:151712452-151712474 GGCCAGAGCAAGGCCCCTGCAGG - Intronic
1035618168 8:1017741-1017763 GCCCACGGCAGGCCCCTTGCAGG - Intergenic
1038038737 8:23706719-23706741 GCCCAGAGGAAGGCGCTGTCTGG - Intergenic
1038453001 8:27651734-27651756 GCCCAGAGCCAGCATCTTCCTGG + Intronic
1041383224 8:57273916-57273938 GGCCAGAGCAAATTGCTTGCTGG - Intergenic
1048321208 8:133401601-133401623 GCCCACAGCAAGCCAACTGCAGG - Intergenic
1049600144 8:143503837-143503859 GTCCAGAGAAAGCCGCTGACAGG + Intronic
1050382160 9:5042012-5042034 GCCCAGGGCCAGACGCTGGCTGG + Intronic
1051199222 9:14598114-14598136 GCCCAGAGCAAGCTGCCTGGAGG + Intergenic
1051411684 9:16795928-16795950 TCCAAGAGCAAGCCACTTTCAGG + Intronic
1055422747 9:76161298-76161320 GCCCTCAGCAGGCCGCCTGCAGG + Intronic
1056501808 9:87217057-87217079 GCCAGGAGCAAGCCACTGGCGGG - Intergenic
1058358329 9:104108850-104108872 ACCCAGGGCAAGCTGCTTTCTGG - Intronic
1061016100 9:127981420-127981442 GCCCAGAGAGAGCCCCTGGCAGG + Intergenic
1061252657 9:129435885-129435907 GCCCAGAGGTAGCCGCCTGCAGG - Intergenic
1062097791 9:134711880-134711902 GCCCAGCGCCATCCACTTGCGGG - Intronic
1062388868 9:136326258-136326280 GCGCAGCGCAAGCTGCCTGCTGG - Intergenic
1188751817 X:33913696-33913718 GCCTACAGCAAGACTCTTGCTGG + Intergenic
1190061229 X:47212984-47213006 TCTCAGAGCAAGCTGATTGCAGG + Exonic
1191671149 X:63750156-63750178 GCCCAGAGCAAGCACTCTGCAGG + Intronic
1195262382 X:103145533-103145555 GCCCACTGCAAGCCGCTCCCGGG + Intergenic
1196395841 X:115261133-115261155 GCCCACAGCACTCCACTTGCAGG + Intergenic
1200067249 X:153509796-153509818 GCCAAGAGCACGCCGACTGCAGG + Intergenic