ID: 1003460232

View in Genome Browser
Species Human (GRCh38)
Location 6:6321864-6321886
Sequence TTGGAGATGCAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003460232_1003460242 9 Left 1003460232 6:6321864-6321886 CCCTCCTCCCTCTGCATCTCCAA No data
Right 1003460242 6:6321896-6321918 CTGCGTTGCCTTGTTCTCCGGGG No data
1003460232_1003460240 7 Left 1003460232 6:6321864-6321886 CCCTCCTCCCTCTGCATCTCCAA No data
Right 1003460240 6:6321894-6321916 TTCTGCGTTGCCTTGTTCTCCGG No data
1003460232_1003460241 8 Left 1003460232 6:6321864-6321886 CCCTCCTCCCTCTGCATCTCCAA No data
Right 1003460241 6:6321895-6321917 TCTGCGTTGCCTTGTTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003460232 Original CRISPR TTGGAGATGCAGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr