ID: 1003460432

View in Genome Browser
Species Human (GRCh38)
Location 6:6323407-6323429
Sequence CAAGATACCCTCATCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003460429_1003460432 11 Left 1003460429 6:6323373-6323395 CCTGGCAAACATCAAATCTGAGT No data
Right 1003460432 6:6323407-6323429 CAAGATACCCTCATCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003460432 Original CRISPR CAAGATACCCTCATCCATGT GGG Intergenic
No off target data available for this crispr