ID: 1003461441

View in Genome Browser
Species Human (GRCh38)
Location 6:6332448-6332470
Sequence TCTTGCATGCGGTTTGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003461441_1003461448 20 Left 1003461441 6:6332448-6332470 CCCTGCACAAACCGCATGCAAGA No data
Right 1003461448 6:6332491-6332513 ACATGCTTCACTTCTCCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003461441 Original CRISPR TCTTGCATGCGGTTTGTGCA GGG (reversed) Intergenic
No off target data available for this crispr