ID: 1003469817

View in Genome Browser
Species Human (GRCh38)
Location 6:6418885-6418907
Sequence CTTTAAGTGCAGGCTGCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003469817_1003469822 9 Left 1003469817 6:6418885-6418907 CCGTGTGCAGCCTGCACTTAAAG No data
Right 1003469822 6:6418917-6418939 CTATGCTTACCTTTCTTGAGGGG No data
1003469817_1003469821 8 Left 1003469817 6:6418885-6418907 CCGTGTGCAGCCTGCACTTAAAG No data
Right 1003469821 6:6418916-6418938 ACTATGCTTACCTTTCTTGAGGG No data
1003469817_1003469820 7 Left 1003469817 6:6418885-6418907 CCGTGTGCAGCCTGCACTTAAAG No data
Right 1003469820 6:6418915-6418937 AACTATGCTTACCTTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003469817 Original CRISPR CTTTAAGTGCAGGCTGCACA CGG (reversed) Intergenic
No off target data available for this crispr