ID: 1003469924

View in Genome Browser
Species Human (GRCh38)
Location 6:6420103-6420125
Sequence AGTTACCTGCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003469917_1003469924 16 Left 1003469917 6:6420064-6420086 CCCAGTGACAACCCAAGAACTGA No data
Right 1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG No data
1003469921_1003469924 4 Left 1003469921 6:6420076-6420098 CCAAGAACTGACTTTCAAAAGGA No data
Right 1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG No data
1003469918_1003469924 15 Left 1003469918 6:6420065-6420087 CCAGTGACAACCCAAGAACTGAC No data
Right 1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG No data
1003469919_1003469924 5 Left 1003469919 6:6420075-6420097 CCCAAGAACTGACTTTCAAAAGG No data
Right 1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003469924 Original CRISPR AGTTACCTGCAGATGGTGGA AGG Intergenic
No off target data available for this crispr