ID: 1003477268

View in Genome Browser
Species Human (GRCh38)
Location 6:6494997-6495019
Sequence GCCAGAGGTGTGACTACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003477268_1003477271 30 Left 1003477268 6:6494997-6495019 CCGGCTGTAGTCACACCTCTGGC No data
Right 1003477271 6:6495050-6495072 ACTCTCTTGCAGTAAACCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003477268 Original CRISPR GCCAGAGGTGTGACTACAGC CGG (reversed) Intergenic
No off target data available for this crispr